ID: 990940719

View in Genome Browser
Species Human (GRCh38)
Location 5:61200537-61200559
Sequence CAAGGAGGCCCCACTGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990940712_990940719 3 Left 990940712 5:61200511-61200533 CCTGGCCTGAGTAGCTAAAATTC No data
Right 990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG No data
990940713_990940719 -2 Left 990940713 5:61200516-61200538 CCTGAGTAGCTAAAATTCCCACA No data
Right 990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG No data
990940710_990940719 5 Left 990940710 5:61200509-61200531 CCCCTGGCCTGAGTAGCTAAAAT No data
Right 990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG No data
990940711_990940719 4 Left 990940711 5:61200510-61200532 CCCTGGCCTGAGTAGCTAAAATT No data
Right 990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990940719 Original CRISPR CAAGGAGGCCCCACTGGTTG AGG Intergenic
No off target data available for this crispr