ID: 990951833

View in Genome Browser
Species Human (GRCh38)
Location 5:61305961-61305983
Sequence ATGAGAAAACAGAGGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990951833_990951844 12 Left 990951833 5:61305961-61305983 CCCCCATCCCTCTGTTTTCTCAT No data
Right 990951844 5:61305996-61306018 AAGGATAACAGGGAGTTGCAGGG No data
990951833_990951841 1 Left 990951833 5:61305961-61305983 CCCCCATCCCTCTGTTTTCTCAT No data
Right 990951841 5:61305985-61306007 TGTAAAATTGGAAGGATAACAGG No data
990951833_990951846 21 Left 990951833 5:61305961-61305983 CCCCCATCCCTCTGTTTTCTCAT No data
Right 990951846 5:61306005-61306027 AGGGAGTTGCAGGGTCTACTGGG No data
990951833_990951842 2 Left 990951833 5:61305961-61305983 CCCCCATCCCTCTGTTTTCTCAT No data
Right 990951842 5:61305986-61306008 GTAAAATTGGAAGGATAACAGGG No data
990951833_990951840 -7 Left 990951833 5:61305961-61305983 CCCCCATCCCTCTGTTTTCTCAT No data
Right 990951840 5:61305977-61305999 TTCTCATCTGTAAAATTGGAAGG No data
990951833_990951843 11 Left 990951833 5:61305961-61305983 CCCCCATCCCTCTGTTTTCTCAT No data
Right 990951843 5:61305995-61306017 GAAGGATAACAGGGAGTTGCAGG No data
990951833_990951845 20 Left 990951833 5:61305961-61305983 CCCCCATCCCTCTGTTTTCTCAT No data
Right 990951845 5:61306004-61306026 CAGGGAGTTGCAGGGTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990951833 Original CRISPR ATGAGAAAACAGAGGGATGG GGG (reversed) Intergenic
No off target data available for this crispr