ID: 990954666

View in Genome Browser
Species Human (GRCh38)
Location 5:61331003-61331025
Sequence GCGTGCCAGGCGGCGGACGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990954666_990954672 -5 Left 990954666 5:61331003-61331025 CCGCCGTCCGCCGCCTGGCACGC No data
Right 990954672 5:61331021-61331043 CACGCCGTCTGCCGCCTGCTGGG No data
990954666_990954678 19 Left 990954666 5:61331003-61331025 CCGCCGTCCGCCGCCTGGCACGC No data
Right 990954678 5:61331045-61331067 GATGTGTGCGCGAGCCCGTGGGG No data
990954666_990954677 18 Left 990954666 5:61331003-61331025 CCGCCGTCCGCCGCCTGGCACGC No data
Right 990954677 5:61331044-61331066 CGATGTGTGCGCGAGCCCGTGGG No data
990954666_990954671 -6 Left 990954666 5:61331003-61331025 CCGCCGTCCGCCGCCTGGCACGC No data
Right 990954671 5:61331020-61331042 GCACGCCGTCTGCCGCCTGCTGG No data
990954666_990954676 17 Left 990954666 5:61331003-61331025 CCGCCGTCCGCCGCCTGGCACGC No data
Right 990954676 5:61331043-61331065 GCGATGTGTGCGCGAGCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990954666 Original CRISPR GCGTGCCAGGCGGCGGACGG CGG (reversed) Intergenic