ID: 990954671

View in Genome Browser
Species Human (GRCh38)
Location 5:61331020-61331042
Sequence GCACGCCGTCTGCCGCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990954664_990954671 0 Left 990954664 5:61330997-61331019 CCGAAGCCGCCGTCCGCCGCCTG No data
Right 990954671 5:61331020-61331042 GCACGCCGTCTGCCGCCTGCTGG No data
990954660_990954671 18 Left 990954660 5:61330979-61331001 CCGCAGACCCAAGTGCGCCCGAA No data
Right 990954671 5:61331020-61331042 GCACGCCGTCTGCCGCCTGCTGG No data
990954662_990954671 10 Left 990954662 5:61330987-61331009 CCAAGTGCGCCCGAAGCCGCCGT No data
Right 990954671 5:61331020-61331042 GCACGCCGTCTGCCGCCTGCTGG No data
990954666_990954671 -6 Left 990954666 5:61331003-61331025 CCGCCGTCCGCCGCCTGGCACGC No data
Right 990954671 5:61331020-61331042 GCACGCCGTCTGCCGCCTGCTGG No data
990954661_990954671 11 Left 990954661 5:61330986-61331008 CCCAAGTGCGCCCGAAGCCGCCG No data
Right 990954671 5:61331020-61331042 GCACGCCGTCTGCCGCCTGCTGG No data
990954659_990954671 23 Left 990954659 5:61330974-61330996 CCGGGCCGCAGACCCAAGTGCGC No data
Right 990954671 5:61331020-61331042 GCACGCCGTCTGCCGCCTGCTGG No data
990954663_990954671 1 Left 990954663 5:61330996-61331018 CCCGAAGCCGCCGTCCGCCGCCT No data
Right 990954671 5:61331020-61331042 GCACGCCGTCTGCCGCCTGCTGG No data
990954667_990954671 -9 Left 990954667 5:61331006-61331028 CCGTCCGCCGCCTGGCACGCCGT No data
Right 990954671 5:61331020-61331042 GCACGCCGTCTGCCGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990954671 Original CRISPR GCACGCCGTCTGCCGCCTGC TGG Intergenic