ID: 990954676

View in Genome Browser
Species Human (GRCh38)
Location 5:61331043-61331065
Sequence GCGATGTGTGCGCGAGCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990954667_990954676 14 Left 990954667 5:61331006-61331028 CCGTCCGCCGCCTGGCACGCCGT No data
Right 990954676 5:61331043-61331065 GCGATGTGTGCGCGAGCCCGTGG No data
990954669_990954676 7 Left 990954669 5:61331013-61331035 CCGCCTGGCACGCCGTCTGCCGC No data
Right 990954676 5:61331043-61331065 GCGATGTGTGCGCGAGCCCGTGG No data
990954664_990954676 23 Left 990954664 5:61330997-61331019 CCGAAGCCGCCGTCCGCCGCCTG No data
Right 990954676 5:61331043-61331065 GCGATGTGTGCGCGAGCCCGTGG No data
990954673_990954676 -5 Left 990954673 5:61331025-61331047 CCGTCTGCCGCCTGCTGGGCGAT No data
Right 990954676 5:61331043-61331065 GCGATGTGTGCGCGAGCCCGTGG No data
990954666_990954676 17 Left 990954666 5:61331003-61331025 CCGCCGTCCGCCGCCTGGCACGC No data
Right 990954676 5:61331043-61331065 GCGATGTGTGCGCGAGCCCGTGG No data
990954668_990954676 10 Left 990954668 5:61331010-61331032 CCGCCGCCTGGCACGCCGTCTGC No data
Right 990954676 5:61331043-61331065 GCGATGTGTGCGCGAGCCCGTGG No data
990954670_990954676 4 Left 990954670 5:61331016-61331038 CCTGGCACGCCGTCTGCCGCCTG No data
Right 990954676 5:61331043-61331065 GCGATGTGTGCGCGAGCCCGTGG No data
990954663_990954676 24 Left 990954663 5:61330996-61331018 CCCGAAGCCGCCGTCCGCCGCCT No data
Right 990954676 5:61331043-61331065 GCGATGTGTGCGCGAGCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990954676 Original CRISPR GCGATGTGTGCGCGAGCCCG TGG Intergenic