ID: 990954678

View in Genome Browser
Species Human (GRCh38)
Location 5:61331045-61331067
Sequence GATGTGTGCGCGAGCCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990954663_990954678 26 Left 990954663 5:61330996-61331018 CCCGAAGCCGCCGTCCGCCGCCT No data
Right 990954678 5:61331045-61331067 GATGTGTGCGCGAGCCCGTGGGG No data
990954673_990954678 -3 Left 990954673 5:61331025-61331047 CCGTCTGCCGCCTGCTGGGCGAT No data
Right 990954678 5:61331045-61331067 GATGTGTGCGCGAGCCCGTGGGG No data
990954664_990954678 25 Left 990954664 5:61330997-61331019 CCGAAGCCGCCGTCCGCCGCCTG No data
Right 990954678 5:61331045-61331067 GATGTGTGCGCGAGCCCGTGGGG No data
990954670_990954678 6 Left 990954670 5:61331016-61331038 CCTGGCACGCCGTCTGCCGCCTG No data
Right 990954678 5:61331045-61331067 GATGTGTGCGCGAGCCCGTGGGG No data
990954674_990954678 -10 Left 990954674 5:61331032-61331054 CCGCCTGCTGGGCGATGTGTGCG No data
Right 990954678 5:61331045-61331067 GATGTGTGCGCGAGCCCGTGGGG No data
990954667_990954678 16 Left 990954667 5:61331006-61331028 CCGTCCGCCGCCTGGCACGCCGT No data
Right 990954678 5:61331045-61331067 GATGTGTGCGCGAGCCCGTGGGG No data
990954668_990954678 12 Left 990954668 5:61331010-61331032 CCGCCGCCTGGCACGCCGTCTGC No data
Right 990954678 5:61331045-61331067 GATGTGTGCGCGAGCCCGTGGGG No data
990954666_990954678 19 Left 990954666 5:61331003-61331025 CCGCCGTCCGCCGCCTGGCACGC No data
Right 990954678 5:61331045-61331067 GATGTGTGCGCGAGCCCGTGGGG No data
990954669_990954678 9 Left 990954669 5:61331013-61331035 CCGCCTGGCACGCCGTCTGCCGC No data
Right 990954678 5:61331045-61331067 GATGTGTGCGCGAGCCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990954678 Original CRISPR GATGTGTGCGCGAGCCCGTG GGG Intergenic