ID: 990954875

View in Genome Browser
Species Human (GRCh38)
Location 5:61331782-61331804
Sequence CTCGTGGGTCGCAGCGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990954875_990954888 26 Left 990954875 5:61331782-61331804 CCTCCCCCGCTGCGACCCACGAG No data
Right 990954888 5:61331831-61331853 AGAGAAGCTGAGAACTGGAGGGG No data
990954875_990954887 25 Left 990954875 5:61331782-61331804 CCTCCCCCGCTGCGACCCACGAG No data
Right 990954887 5:61331830-61331852 AAGAGAAGCTGAGAACTGGAGGG No data
990954875_990954886 24 Left 990954875 5:61331782-61331804 CCTCCCCCGCTGCGACCCACGAG No data
Right 990954886 5:61331829-61331851 AAAGAGAAGCTGAGAACTGGAGG No data
990954875_990954885 21 Left 990954875 5:61331782-61331804 CCTCCCCCGCTGCGACCCACGAG No data
Right 990954885 5:61331826-61331848 TTCAAAGAGAAGCTGAGAACTGG No data
990954875_990954883 -4 Left 990954875 5:61331782-61331804 CCTCCCCCGCTGCGACCCACGAG No data
Right 990954883 5:61331801-61331823 CGAGGCGCATCCTCACTTCTCGG No data
990954875_990954889 27 Left 990954875 5:61331782-61331804 CCTCCCCCGCTGCGACCCACGAG No data
Right 990954889 5:61331832-61331854 GAGAAGCTGAGAACTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990954875 Original CRISPR CTCGTGGGTCGCAGCGGGGG AGG (reversed) Intergenic
No off target data available for this crispr