ID: 990954878

View in Genome Browser
Species Human (GRCh38)
Location 5:61331786-61331808
Sequence GCGCCTCGTGGGTCGCAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990954878_990954885 17 Left 990954878 5:61331786-61331808 CCCCGCTGCGACCCACGAGGCGC No data
Right 990954885 5:61331826-61331848 TTCAAAGAGAAGCTGAGAACTGG No data
990954878_990954889 23 Left 990954878 5:61331786-61331808 CCCCGCTGCGACCCACGAGGCGC No data
Right 990954889 5:61331832-61331854 GAGAAGCTGAGAACTGGAGGGGG No data
990954878_990954886 20 Left 990954878 5:61331786-61331808 CCCCGCTGCGACCCACGAGGCGC No data
Right 990954886 5:61331829-61331851 AAAGAGAAGCTGAGAACTGGAGG No data
990954878_990954883 -8 Left 990954878 5:61331786-61331808 CCCCGCTGCGACCCACGAGGCGC No data
Right 990954883 5:61331801-61331823 CGAGGCGCATCCTCACTTCTCGG No data
990954878_990954890 29 Left 990954878 5:61331786-61331808 CCCCGCTGCGACCCACGAGGCGC No data
Right 990954890 5:61331838-61331860 CTGAGAACTGGAGGGGGAAGTGG No data
990954878_990954891 30 Left 990954878 5:61331786-61331808 CCCCGCTGCGACCCACGAGGCGC No data
Right 990954891 5:61331839-61331861 TGAGAACTGGAGGGGGAAGTGGG No data
990954878_990954888 22 Left 990954878 5:61331786-61331808 CCCCGCTGCGACCCACGAGGCGC No data
Right 990954888 5:61331831-61331853 AGAGAAGCTGAGAACTGGAGGGG No data
990954878_990954887 21 Left 990954878 5:61331786-61331808 CCCCGCTGCGACCCACGAGGCGC No data
Right 990954887 5:61331830-61331852 AAGAGAAGCTGAGAACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990954878 Original CRISPR GCGCCTCGTGGGTCGCAGCG GGG (reversed) Intergenic
No off target data available for this crispr