ID: 990955220

View in Genome Browser
Species Human (GRCh38)
Location 5:61333059-61333081
Sequence GGCCAGTGAGGACACCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990955220_990955225 -3 Left 990955220 5:61333059-61333081 CCCTGCGGGTGTCCTCACTGGCC 0: 1
1: 0
2: 3
3: 8
4: 103
Right 990955225 5:61333079-61333101 GCCCGGACGGTCCTCCTGAGCGG 0: 1
1: 0
2: 1
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990955220 Original CRISPR GGCCAGTGAGGACACCCGCA GGG (reversed) Intronic
901807557 1:11748007-11748029 GGGCAGTGAGCACTCCCGCACGG + Intronic
902513360 1:16977827-16977849 GGCCAGTAGGGACCCCCACAAGG + Intronic
904681861 1:32234780-32234802 GGCCAGTGAAGTCACAAGCAGGG + Intergenic
907304237 1:53504987-53505009 AGCCAGTGAGGAGCCCAGCATGG - Intergenic
912473668 1:109922868-109922890 GGCCAGTGGGAACCCCTGCATGG + Intronic
912501026 1:110121875-110121897 GCCCAGTGAGGTCAGCCACAGGG - Intergenic
915232202 1:154453988-154454010 GGCAAGAGATGACACCCCCATGG + Intronic
915355578 1:155253789-155253811 GGCCTGTGAGTACCCCAGCAGGG + Intronic
919805376 1:201378210-201378232 CCCCAGTGAGGACATCTGCAAGG + Intronic
919892219 1:201983363-201983385 GGCCAGGGAGGAGACGCGGAAGG - Intronic
920525623 1:206663918-206663940 GGCCAGTGAGGAGGCCAGAAGGG + Intronic
1063461249 10:6216233-6216255 GGCCGGTGAGGACACCCTCATGG - Intronic
1068374846 10:56165069-56165091 AGCCTGTGAGGACAGCTGCAGGG + Intergenic
1069745170 10:70710381-70710403 GGCCAGTGAGGGCCCATGCAGGG - Intronic
1071296061 10:84220904-84220926 GGCCAGTGAGGGAAACGGCAGGG + Intronic
1071568621 10:86684466-86684488 GGCCAGTGCTGACAGCTGCAGGG - Intronic
1071931080 10:90470997-90471019 GGCCAGTTAGCAAACCCACATGG - Intergenic
1073059291 10:100723960-100723982 GGCCAGAGAGGAGGCCCGCGAGG + Intergenic
1076696511 10:132249813-132249835 GGGCAGTGCGGAGACCCTCATGG - Intronic
1076791190 10:132777677-132777699 GTACAGTGAGGACGCCCGCCAGG + Exonic
1077315765 11:1918746-1918768 GGCCAGTGAGGCCACCAGATTGG - Intergenic
1080715131 11:34792668-34792690 GGCCAGAGAGGACCCCCAAAAGG - Intergenic
1083700851 11:64476883-64476905 GGCCAGTTTGGAGACCCTCAAGG + Intergenic
1085387526 11:76165462-76165484 GCACAGGGAGGACACACGCACGG + Intergenic
1088440399 11:109864633-109864655 TGCCAGTGAGAACAACTGCACGG + Intergenic
1096490208 12:52008903-52008925 TGCCAGTGTGGAAACCAGCAAGG + Intronic
1102520763 12:113476498-113476520 GGCCAGAGAGGACGCCGGCGGGG + Intergenic
1104790983 12:131482102-131482124 GGCCAGTGTGGACATCAGGAAGG + Intergenic
1107012638 13:35683456-35683478 GCTCAGTGAGGACACCCGTCAGG - Intergenic
1108468920 13:50748562-50748584 GTCACCTGAGGACACCCGCATGG - Intronic
1121734577 14:96209033-96209055 GACCACTTAGGAAACCCGCAGGG - Intronic
1122327959 14:100893905-100893927 GGCCAGTGAGGACGCCAGCGAGG - Intergenic
1129954679 15:79624961-79624983 AGCCACTGTGGACACTCGCAAGG + Intergenic
1130648953 15:85751427-85751449 GGCCCGGGGGGACACCCACAGGG - Intergenic
1132375534 15:101326019-101326041 GGCCTGTGAGGACAGCACCAGGG + Intronic
1140222701 16:73055646-73055668 CCCCAGTGAAGACACCCACACGG + Intronic
1141503986 16:84462792-84462814 GGCCAGTGAGGCAGCCCCCATGG + Intronic
1141649156 16:85384023-85384045 GGCCAGTGATCACATCCACATGG + Intergenic
1142079968 16:88143791-88143813 GGCCTGGGAGGACACAGGCAGGG - Intergenic
1145997247 17:29111767-29111789 GGCCAGTGAGGACACCCTCCTGG - Exonic
1148555632 17:48577259-48577281 GGCGTGTGAGGACTCCCCCAAGG + Intronic
1157685515 18:49639818-49639840 GGCCAGTGCGCACAGCTGCAGGG + Intergenic
1160497905 18:79385994-79386016 GGCCAATGAGGACAGCTTCACGG - Intergenic
1163391158 19:17030808-17030830 AGCCAATGAGGACACTAGCATGG + Intergenic
1164452999 19:28382733-28382755 CACCAGTGAGGACTCCCACAAGG - Intergenic
1165778645 19:38419762-38419784 GGACTGAGAGGACACCTGCATGG - Intronic
1166009067 19:39927686-39927708 GGCCAGAGAGGACAGCCACGGGG + Exonic
933102331 2:78275928-78275950 GGCCATTCAGGACACAGGCATGG + Intergenic
937921600 2:127135389-127135411 GGCCTGTGAGGACTCTCCCAAGG - Intergenic
938343369 2:130549670-130549692 GCCCGATGAGGACACCCGCCAGG - Intronic
938346464 2:130571052-130571074 GCCCGATGAGGACACCCGCCAGG + Intronic
947517740 2:230822097-230822119 GGTCAGTGAGGACACAGCCATGG - Intergenic
947744545 2:232500824-232500846 GGGCAGTGAGAAGACCCCCAGGG + Intergenic
947799615 2:232920463-232920485 GGCCAGTGAGGACACCCCGGAGG - Exonic
948666093 2:239535750-239535772 GGCCATTTAGGAGACCCTCAGGG - Intergenic
948874081 2:240818202-240818224 GCCCGGGGAGGACACCTGCAGGG + Intronic
1172108312 20:32529704-32529726 GGCCAGTGAGGTCACCTCCCAGG - Intronic
1172785262 20:37464456-37464478 GGCCCGGGAGGACACAGGCAAGG - Intergenic
1178725425 21:35047060-35047082 GGCCAGTAAGGAGAGCCCCAGGG + Intronic
1179634159 21:42696692-42696714 GGCCAGTGAGGACCCGTGCCAGG - Intronic
1179836616 21:44038880-44038902 AGCCAGTGAGGACACACGTGAGG + Intronic
1180189271 21:46154853-46154875 GGCCACAGGGGTCACCCGCAGGG - Intronic
1180903900 22:19395024-19395046 GGGTGGTGAGGATACCCGCAAGG + Intronic
1181738195 22:24898433-24898455 GGACAGTGAGGACAACCTCTCGG + Exonic
1181851098 22:25750548-25750570 GGCCAGTGAGAACACCAGCATGG - Intronic
1185001492 22:48249155-48249177 GGACACTGAGGACACCTACATGG + Intergenic
1185149098 22:49154128-49154150 GGCCAAGAAGGACCCCCGCAAGG - Intergenic
950398957 3:12755746-12755768 GGCCAGTGGGGAGCCCCACAAGG + Intronic
954902422 3:54031317-54031339 GGCCAGTGAGGACAGAAGGAGGG - Intergenic
961358191 3:126352004-126352026 GGCCCATGAGGAGACCGGCAGGG + Exonic
961569504 3:127787663-127787685 CTCCAGCGAGGACACCCTCAGGG - Intronic
962255743 3:133869048-133869070 GGGCAGTCAGGACACCTGCAAGG + Intronic
968271797 3:197408664-197408686 GCCCGGAGAGGAGACCCGCAGGG - Intergenic
971384838 4:26133100-26133122 GGCCAGAGAGGACACCTGCCTGG - Intergenic
972903588 4:43716825-43716847 GGCCAGTGAGTAAACCAACAGGG - Intergenic
979328901 4:119406491-119406513 GCCCAGAGAGGACACCCGGAGGG + Intergenic
985642338 5:1069495-1069517 GGACAGAGGGGGCACCCGCATGG + Intronic
985782907 5:1880371-1880393 GGGCAGTGTGGACACTCGGAAGG + Intronic
988908478 5:35815185-35815207 AGCCAATGAGGAGACCCACAGGG - Intergenic
989171414 5:38473134-38473156 GGCCTGTGAAGCCTCCCGCAAGG + Intergenic
990955220 5:61333059-61333081 GGCCAGTGAGGACACCCGCAGGG - Intronic
991028027 5:62052033-62052055 TGCCAGTGTGAACACACGCATGG - Intergenic
997862268 5:137428689-137428711 GGCCAGTGAGGAGAGCCAGAGGG - Intronic
1003119361 6:3307203-3307225 AGCCAGTGAGGACACCTGCCTGG - Intronic
1004434496 6:15577364-15577386 GCCCAGGGAGGATGCCCGCACGG + Intronic
1004721390 6:18270531-18270553 GGTCAGGGAGGACCCCCTCAAGG + Intergenic
1006423758 6:33951137-33951159 CGCCAATGAGGACACACCCAGGG + Intergenic
1006836091 6:36999552-36999574 GGACAGTGAGGACTCCCCAAAGG - Intergenic
1007471897 6:42096278-42096300 AGCAAGAGAGGACACCCACAAGG + Intergenic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1010774013 6:79864489-79864511 GGCCTGTGTGGAGACCTGCAAGG - Intergenic
1012474203 6:99603356-99603378 GGCCAGCGCGGACACCCTCGGGG + Intergenic
1018090649 6:160345062-160345084 GGCCTGAGTGGGCACCCGCAAGG - Intergenic
1019520592 7:1459024-1459046 GGCCACTGAGGACAGCCTCGGGG + Intronic
1023025265 7:36044015-36044037 GCTCAGTTAGGACACACGCAGGG - Intergenic
1023920935 7:44629384-44629406 GGCCAATGATGGCACCCTCAAGG - Intronic
1024238699 7:47417036-47417058 GGGCACTGAGAACACCCCCAGGG - Intronic
1025611668 7:63080235-63080257 GGGCAGTCAGGACTCCAGCAGGG + Intergenic
1027234555 7:76290428-76290450 GGCCAGTGAGGAGGCCGGTAGGG - Intergenic
1034749486 7:153555439-153555461 CTCCAGTGAGGACACTCCCAGGG + Intergenic
1038056342 8:23861801-23861823 GGCCAGTGAGGGCAACGACAGGG - Intergenic
1038943911 8:32336086-32336108 GTCCAGAGAAGACACCCACAGGG + Intronic
1041407995 8:57521752-57521774 GGGCAGTGTGGACACCCGAGTGG - Intergenic
1045571255 8:103371368-103371390 GGCCTGTCAGGACCCCCGCGGGG - Intergenic
1046780685 8:118211383-118211405 GGCCACTGTGGACAGCAGCAAGG - Intronic
1047698378 8:127426437-127426459 GGCCATTGAGGACCCAGGCATGG - Intergenic
1048285374 8:133137279-133137301 GGCCAGTGAGGACAGAGGAAGGG - Intergenic
1049550017 8:143252867-143252889 GGCCAGTGTTGACCCCCACAGGG + Intronic
1053285371 9:36846773-36846795 GGCCAGTGAGGAGGCCTGGATGG + Intronic
1057024747 9:91726256-91726278 GGACAGTGAGGACACTCGCTGGG + Intronic
1061911952 9:133729654-133729676 GGGCAGTGAGGGGACCCACAAGG + Intronic
1189265677 X:39714405-39714427 GGCCAGTGAGGATACTCTCCGGG - Intergenic
1190259036 X:48786564-48786586 GGCCAGCCAGGACACCCCCTGGG + Exonic
1192582881 X:72299486-72299508 GGGCAGTGTGGACACAGGCATGG - Intronic
1193206135 X:78749846-78749868 AGCCAGTAAGGCCACCAGCATGG + Intronic