ID: 990955287

View in Genome Browser
Species Human (GRCh38)
Location 5:61333254-61333276
Sequence AGGGCTGTTCGCCGGTTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 11}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990955273_990955287 10 Left 990955273 5:61333221-61333243 CCTACCCGCCCTCCTCCGGGGAG 0: 1
1: 1
2: 0
3: 26
4: 252
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955267_990955287 19 Left 990955267 5:61333212-61333234 CCGCGCTCCCCTACCCGCCCTCC 0: 1
1: 0
2: 7
3: 107
4: 1249
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955276_990955287 2 Left 990955276 5:61333229-61333251 CCCTCCTCCGGGGAGCACATCCT 0: 1
1: 0
2: 0
3: 23
4: 159
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955279_990955287 -2 Left 990955279 5:61333233-61333255 CCTCCGGGGAGCACATCCTGGAG 0: 1
1: 0
2: 1
3: 12
4: 138
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955275_990955287 5 Left 990955275 5:61333226-61333248 CCGCCCTCCTCCGGGGAGCACAT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955264_990955287 25 Left 990955264 5:61333206-61333228 CCCGGCCCGCGCTCCCCTACCCG 0: 1
1: 0
2: 6
3: 34
4: 393
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955282_990955287 -5 Left 990955282 5:61333236-61333258 CCGGGGAGCACATCCTGGAGGGC 0: 1
1: 0
2: 3
3: 30
4: 252
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955263_990955287 26 Left 990955263 5:61333205-61333227 CCCCGGCCCGCGCTCCCCTACCC 0: 1
1: 0
2: 12
3: 59
4: 536
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955262_990955287 27 Left 990955262 5:61333204-61333226 CCCCCGGCCCGCGCTCCCCTACC 0: 1
1: 0
2: 1
3: 40
4: 399
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955266_990955287 20 Left 990955266 5:61333211-61333233 CCCGCGCTCCCCTACCCGCCCTC 0: 1
1: 0
2: 2
3: 44
4: 629
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955277_990955287 1 Left 990955277 5:61333230-61333252 CCTCCTCCGGGGAGCACATCCTG 0: 1
1: 0
2: 2
3: 21
4: 239
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955274_990955287 6 Left 990955274 5:61333225-61333247 CCCGCCCTCCTCCGGGGAGCACA 0: 1
1: 1
2: 1
3: 25
4: 257
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955265_990955287 24 Left 990955265 5:61333207-61333229 CCGGCCCGCGCTCCCCTACCCGC 0: 1
1: 0
2: 3
3: 57
4: 506
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955272_990955287 11 Left 990955272 5:61333220-61333242 CCCTACCCGCCCTCCTCCGGGGA 0: 1
1: 0
2: 1
3: 10
4: 176
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11
990955270_990955287 12 Left 990955270 5:61333219-61333241 CCCCTACCCGCCCTCCTCCGGGG 0: 1
1: 0
2: 1
3: 15
4: 257
Right 990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG 0: 1
1: 0
2: 1
3: 0
4: 11

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990955287 Original CRISPR AGGGCTGTTCGCCGGTTTCG GGG Intronic
1089585016 11:119504877-119504899 AGGGCTGTTCTCCAGTCTTGGGG + Intergenic
1113218768 13:108074107-108074129 AGGGCTGCTTGCTGGTTTTGAGG - Intergenic
1130876774 15:88021354-88021376 AGGGCTGTTCTGGGGTTTGGGGG - Intronic
1134406246 16:13961464-13961486 CAGGCTGTTCGCCGGTTTCGAGG + Intergenic
1151308698 17:73280350-73280372 AGGGCTGTGCGCCCGTTTACTGG - Intergenic
1152508569 17:80770100-80770122 AGGGCTGTTCTCTGCATTCGAGG + Intronic
933381608 2:81554453-81554475 AGGGCTGTTCCCCACTTTGGTGG - Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
965957492 3:174388920-174388942 AGGGCTCTTCCCCTGTTTCTTGG - Intergenic
990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG + Intronic
1018378178 6:163232896-163232918 AGGGCTGAGGGCTGGTTTCGGGG - Intronic
1035517084 8:243711-243733 AGAGCTGTTTGCCTGTTTTGGGG - Exonic
1049229898 8:141476522-141476544 AGGGCTGGACGCAGCTTTCGAGG - Intergenic