ID: 990955823

View in Genome Browser
Species Human (GRCh38)
Location 5:61337159-61337181
Sequence AATCCCGCCGCTCGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990955815_990955823 30 Left 990955815 5:61337106-61337128 CCTCATCTCTACTAAAAATACAA 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
Right 990955823 5:61337159-61337181 AATCCCGCCGCTCGGGAGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 184
990955819_990955823 0 Left 990955819 5:61337136-61337158 CCAGAGCGGTTGCGGGCGTCTGT 0: 1
1: 0
2: 1
3: 24
4: 379
Right 990955823 5:61337159-61337181 AATCCCGCCGCTCGGGAGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990955823 Original CRISPR AATCCCGCCGCTCGGGAGGC TGG Intronic
900229601 1:1549853-1549875 AATCCCACTGCTCAGGAGGCTGG + Intronic
901322275 1:8347101-8347123 ACTCCCACAGTTCGGGAGGCAGG - Intergenic
902367298 1:15985139-15985161 AATCCAGCTACTCAGGAGGCTGG - Intergenic
902521184 1:17017673-17017695 AATCCAGCTACTCAGGAGGCTGG - Intergenic
903113294 1:21156820-21156842 AATCCCGCACTTTGGGAGGCTGG + Intronic
903632874 1:24790187-24790209 ATCCCAGCCACTCGGGAGGCTGG - Intronic
905446671 1:38032086-38032108 ATCCCAGCCACTCGGGAGGCTGG + Intergenic
906040369 1:42784443-42784465 AATCCCGCAGGGCAGGAGGCAGG - Intronic
908280920 1:62534114-62534136 ATCCCAGCTGCTCGGGAGGCTGG - Intronic
909950987 1:81720292-81720314 AATCCAGCTACTCGGGAGGCTGG - Intronic
910134001 1:83944588-83944610 ATCCCAGCTGCTCGGGAGGCTGG + Intronic
912011866 1:104976734-104976756 AATCCCAGCACTTGGGAGGCCGG + Intergenic
914830381 1:151166675-151166697 AATCGCGACGCTGAGGAGGCAGG - Intronic
915523577 1:156462962-156462984 AATCCCGCTACCTGGGAGGCTGG - Intergenic
916066876 1:161143053-161143075 ATCCCAGCTGCTCGGGAGGCTGG + Intergenic
919968795 1:202557235-202557257 AATCCCAGCACTCTGGAGGCAGG - Intronic
921999923 1:221466707-221466729 ATCCCAGCCACTCGGGAGGCTGG - Intergenic
922468973 1:225863796-225863818 AATCCAGCTACTTGGGAGGCTGG + Intronic
922645652 1:227283937-227283959 AATCCCAGCACTCGGGAGGCTGG + Intronic
923955084 1:239007944-239007966 AGTCCCACTACTCGGGAGGCTGG + Intergenic
924167487 1:241299995-241300017 ATACCAGCCACTCGGGAGGCTGG + Intronic
924515960 1:244766441-244766463 AATCCCAGCACTTGGGAGGCTGG - Intergenic
924944714 1:248838472-248838494 AGTCCCGCAGTCCGGGAGGCGGG + Exonic
1063079738 10:2754507-2754529 AATCCTGCCGCTCCTGAGGCCGG - Intergenic
1064712353 10:18140506-18140528 AAGCGAGCCGCTCGGGAGGCGGG - Intergenic
1066311133 10:34197845-34197867 GTCCCCGCTGCTCGGGAGGCTGG - Intronic
1066353789 10:34662752-34662774 ATTCCAGCTACTCGGGAGGCTGG + Intronic
1072201989 10:93168514-93168536 ATCCCAGCTGCTCGGGAGGCTGG - Intergenic
1072942326 10:99777523-99777545 AATCCAGCTACTCAGGAGGCTGG - Intergenic
1073420600 10:103420991-103421013 ATTCCAGCTACTCGGGAGGCTGG - Intronic
1074234690 10:111573466-111573488 AATCCCAGCACTTGGGAGGCTGG - Intergenic
1075030959 10:119024511-119024533 ATCCCAGCCACTCGGGAGGCTGG + Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1080007795 11:27428253-27428275 AATCCCAGCTCTCGGGAGGCTGG - Intronic
1081518866 11:43862012-43862034 AATCCCAGCACTTGGGAGGCAGG - Intergenic
1081803242 11:45874160-45874182 ATTCCAGCTACTCGGGAGGCTGG + Intronic
1083893526 11:65608733-65608755 AATCCCACTACTCGGGAGGCTGG - Intronic
1084041633 11:66546197-66546219 AATCCCGCGGCGCTGGAGCCCGG + Exonic
1086399124 11:86446476-86446498 AATCCCTCGGCCCTGGAGGCAGG + Exonic
1088771883 11:113043452-113043474 AATCCAGCTACTCAGGAGGCTGG - Intronic
1090750764 11:129744512-129744534 AATCCCGCACTTTGGGAGGCCGG + Intergenic
1090750791 11:129744646-129744668 AATCCCGCACTTTGGGAGGCCGG + Intergenic
1090842402 11:130502875-130502897 ATTCCAGCTACTCGGGAGGCTGG + Intergenic
1091879716 12:3967292-3967314 ATCCCAGCTGCTCGGGAGGCTGG + Intergenic
1092421996 12:8339328-8339350 ATTCCAGCTACTCGGGAGGCAGG - Intergenic
1092749391 12:11704462-11704484 ATCCCAGCTGCTCGGGAGGCTGG - Intronic
1093177195 12:15925937-15925959 AATCCAGCTACTCGGGAGGCAGG - Intronic
1093769745 12:23004608-23004630 AATCCCAGCACTTGGGAGGCTGG + Intergenic
1098253628 12:68594256-68594278 ATACCAGCCACTCGGGAGGCTGG - Intergenic
1100430967 12:94531683-94531705 AATCCCAATGCTTGGGAGGCTGG + Intergenic
1100617718 12:96243886-96243908 ATTCCAGCTGCTTGGGAGGCTGG + Intronic
1102079594 12:110087037-110087059 ATTCCAGCTACTCGGGAGGCTGG + Intergenic
1102295178 12:111730867-111730889 ATCCCAGCTGCTCGGGAGGCTGG - Intronic
1103645719 12:122391033-122391055 AATCCCAACACTTGGGAGGCCGG + Intronic
1105366923 13:19773768-19773790 AACCCAGCTACTCGGGAGGCAGG - Intronic
1105746146 13:23378556-23378578 ATCCCAGCTGCTCGGGAGGCTGG - Intronic
1105969395 13:25414306-25414328 ATCCCAGCTGCTCGGGAGGCTGG - Intronic
1113577114 13:111402657-111402679 AATGCCGCCGCAGGGGAGACCGG - Intergenic
1117978433 14:61320479-61320501 ATTCCAGCTACTCGGGAGGCTGG + Intronic
1119390989 14:74290800-74290822 AATCCAGCTACTCAGGAGGCTGG - Intronic
1121135980 14:91499145-91499167 GTTCCAGCCGCTTGGGAGGCTGG + Intronic
1125180665 15:36878596-36878618 AATCCAGCTGCTGTGGAGGCGGG + Intergenic
1125462469 15:39920179-39920201 AACCCCGGCGCCCGGGAGGCGGG + Exonic
1126025178 15:44439410-44439432 AATCCCAGCACTTGGGAGGCCGG - Intronic
1127218793 15:56854754-56854776 AATCCCGGCACTGGCGAGGCAGG + Intronic
1128263306 15:66247915-66247937 AATCCAGCCACTCGGGAGGCTGG + Intronic
1128270462 15:66304781-66304803 ATCCCAGCTGCTCGGGAGGCTGG + Intronic
1128928466 15:71681034-71681056 AATCCAGCTACTCAGGAGGCTGG - Intronic
1129853633 15:78810084-78810106 AATCCCTCCAGTGGGGAGGCAGG + Intronic
1131114354 15:89784836-89784858 AATACAGCAGCTGGGGAGGCCGG - Intergenic
1132475580 16:135489-135511 AACCCAGCTACTCGGGAGGCTGG + Intronic
1132889241 16:2196080-2196102 ACGCCCGCGGCCCGGGAGGCGGG + Intronic
1133791036 16:9009294-9009316 AGTCCAGCTACTCGGGAGGCTGG - Intergenic
1136789739 16:32959449-32959471 ATTCCAGCTACTCGGGAGGCTGG - Intergenic
1137423800 16:48359469-48359491 AATCCCAGCACTTGGGAGGCAGG + Intronic
1137601467 16:49759279-49759301 ATTCCAGCTACTCGGGAGGCTGG + Intronic
1138992999 16:62414405-62414427 ATTCCAGCTACTCGGGAGGCTGG - Intergenic
1139809306 16:69599457-69599479 ATCCCAGCTGCTCGGGAGGCAGG + Intronic
1139951137 16:70671160-70671182 AATCCCAGCACTTGGGAGGCTGG + Intronic
1140039882 16:71399451-71399473 AACCCAGCTACTCGGGAGGCTGG - Intergenic
1140055363 16:71521181-71521203 ATCCCAGCCACTCGGGAGGCTGG - Intronic
1140277462 16:73523408-73523430 AACCCCGCCTCTAGGGTGGCAGG - Intergenic
1203091942 16_KI270728v1_random:1220920-1220942 ATTCCAGCTACTCGGGAGGCTGG - Intergenic
1142665451 17:1460687-1460709 ATTCCAGCTACTCGGGAGGCTGG - Intronic
1142670586 17:1485858-1485880 AGCCCGGCCGCGCGGGAGGCGGG - Intronic
1143113151 17:4564812-4564834 ATTCCAGCTACTCGGGAGGCTGG - Intergenic
1144336972 17:14280248-14280270 AATCCCGCTACTCGGGAGGCTGG + Intergenic
1145094482 17:20013617-20013639 ATTCCAGCTACTCGGGAGGCTGG - Intronic
1146292082 17:31615736-31615758 ATTCCAGCTACTCGGGAGGCTGG - Intergenic
1146387938 17:32394152-32394174 ATTCCAGCAGCTTGGGAGGCCGG + Intergenic
1148656461 17:49287405-49287427 AATCCCGCTACTCAGGAGACTGG - Intergenic
1148768991 17:50056207-50056229 GACCCGGCCGCTGGGGAGGCAGG + Intronic
1148934223 17:51151910-51151932 ATCCCAGCTGCTCGGGAGGCTGG + Intergenic
1149690999 17:58576364-58576386 AATTCCGCTACTTGGGAGGCTGG + Intronic
1150211988 17:63446590-63446612 AATCCCGCGGCCCTCGAGGCAGG - Intergenic
1150614743 17:66761572-66761594 ATCCCAGCTGCTCGGGAGGCTGG - Intronic
1153623782 18:7004468-7004490 ATCCCAGCTGCTCGGGAGGCTGG - Intronic
1161631676 19:5359917-5359939 ATTCCAGCTACTCGGGAGGCTGG + Intergenic
1161699481 19:5787081-5787103 AGTCCCGCAGCTCGGGCAGCAGG + Exonic
1161938247 19:7385591-7385613 ATCCCCGCTACTCGGGAGGCTGG - Intronic
1162128171 19:8510669-8510691 AATCCCGCCGCTTTGGGGGTGGG - Exonic
1162146077 19:8612669-8612691 AACCCAGCTACTCGGGAGGCTGG - Intergenic
1165010544 19:32843202-32843224 AATCCAGCAGTTTGGGAGGCTGG + Intronic
1165093657 19:33399233-33399255 AATCCCAGCACTTGGGAGGCGGG - Intronic
1165653901 19:37516385-37516407 AATCCCAGCACTTGGGAGGCCGG - Intronic
1166367404 19:42284479-42284501 CCTCCCGCCGCCCGGGGGGCGGG - Intronic
1167572239 19:50295990-50296012 AGTCCAGCTACTCGGGAGGCTGG + Intronic
1168233168 19:55045826-55045848 ATCCCAGCTGCTCGGGAGGCTGG + Intronic
1168258227 19:55178894-55178916 AATCCCGCCCCTCGGAATCCTGG + Intronic
927310654 2:21627461-21627483 ATCCCAGCCACTCGGGAGGCAGG - Intergenic
931280614 2:60788437-60788459 ATTCCAGCTACTCGGGAGGCTGG - Intronic
931772494 2:65510272-65510294 AACCCAGCTACTCGGGAGGCTGG - Intergenic
933896149 2:86811204-86811226 AATCCCAGCACTTGGGAGGCCGG - Intergenic
933966856 2:87437023-87437045 AATCCAGCTACTTGGGAGGCTGG + Intergenic
936326939 2:111513463-111513485 AATCCAGCTACTTGGGAGGCTGG - Intergenic
938073215 2:128318985-128319007 AACCCCGGCACTCCGGAGGCGGG - Intergenic
939481036 2:142747405-142747427 AGTCCCAGCACTCGGGAGGCTGG + Intergenic
939499188 2:142960940-142960962 AATCCCAGCACTTGGGAGGCTGG + Intronic
942311107 2:174657790-174657812 ATTCCAGCTACTCGGGAGGCTGG + Intronic
942578664 2:177393009-177393031 ACTCCCGCCGCGCAGGAGTCGGG + Exonic
942698059 2:178668612-178668634 ATCCCAGCCACTCGGGAGGCTGG + Intronic
943379058 2:187120233-187120255 AATCCAGCTACTCGGGAGGCTGG + Intergenic
944577497 2:201103645-201103667 AACCCAGCTACTCGGGAGGCTGG - Intergenic
945952063 2:216048590-216048612 ATTCCAGCTACTCGGGAGGCTGG + Intronic
948441104 2:237989998-237990020 ATCCCAGCTGCTCGGGAGGCTGG + Intronic
1168770577 20:412436-412458 AATCCAGCTACTCAGGAGGCTGG - Intronic
1168895108 20:1318949-1318971 ATTCCCACAGCTCTGGAGGCTGG - Intronic
1169658310 20:7950973-7950995 ATTCCAGCCACTTGGGAGGCTGG + Intergenic
1174832034 20:53822143-53822165 ATTCCAGCTACTCGGGAGGCTGG - Intergenic
1175435777 20:58946582-58946604 ATTCCAGCTACTCGGGAGGCTGG - Intergenic
1175839082 20:62015209-62015231 GAACCCTCCTCTCGGGAGGCAGG + Intronic
1176273553 20:64248967-64248989 ATCCCAGCTGCTCGGGAGGCTGG + Intergenic
1177949172 21:27512273-27512295 TATCCCACAGCTCTGGAGGCTGG + Intergenic
1179529835 21:42010757-42010779 CATCCCGCCGCGCCGGAAGCGGG - Intergenic
1181091441 22:20475679-20475701 ATCCCAGCCACTCGGGAGGCTGG - Intronic
1182804810 22:33060424-33060446 ATTCCAGCTGCTTGGGAGGCAGG - Intergenic
1183093261 22:35538061-35538083 ATTCCAGCTACTCGGGAGGCTGG - Intergenic
1184182976 22:42843485-42843507 AATCCCAGCACTTGGGAGGCCGG - Intronic
1184245546 22:43234145-43234167 AATCCCGGGGCTCGGGGGGAAGG - Intronic
951898881 3:27637326-27637348 ATTCCAGCCACTCGGGGGGCTGG - Intergenic
953469843 3:43157225-43157247 CATCCAGCTGCACGGGAGGCTGG - Intergenic
954243492 3:49312369-49312391 ATCCCAGCCACTCGGGAGGCTGG + Intronic
954508929 3:51104904-51104926 AGTCCCGCTACTCAGGAGGCTGG - Intronic
954631036 3:52047679-52047701 AATCCTGCCGCTCAGCCGGCAGG - Intergenic
959239833 3:103775936-103775958 ATTCCAGCCACTCGGGAGGCTGG + Intergenic
963394076 3:144709720-144709742 AATCCAGCTACTCAGGAGGCTGG - Intergenic
964288883 3:155153142-155153164 ATTCCAGCTACTCGGGAGGCTGG - Intronic
967518533 3:190400348-190400370 ATCCCAGCCACTCGGGAGGCAGG - Intronic
967909391 3:194528551-194528573 ATTCCAGCTGCTCGGGAGGGAGG - Intergenic
968858139 4:3144433-3144455 ATTCCAGCCACTCAGGAGGCTGG - Intronic
969854420 4:9987708-9987730 AAACCAGCCTCTCGGGAGACTGG + Intronic
976733134 4:88284133-88284155 AAACCCGCCGCCCGGGGCGCAGG + Intronic
979898717 4:126191427-126191449 AATCCCAGCACTTGGGAGGCCGG - Intergenic
984135038 4:175925967-175925989 ATTCCAGCTGCTTGGGAGGCTGG - Intronic
987607603 5:20157758-20157780 AGTCCCGCTACTCAGGAGGCTGG - Intronic
989047336 5:37285702-37285724 AATCCAGTCACTTGGGAGGCTGG - Intergenic
990478584 5:56185548-56185570 ATTCCAGCTACTCGGGAGGCTGG + Intronic
990955823 5:61337159-61337181 AATCCCGCCGCTCGGGAGGCTGG + Intronic
992114306 5:73524802-73524824 AATCACGCTACTTGGGAGGCTGG - Intergenic
993236217 5:85313608-85313630 ATCCCAGCTGCTCGGGAGGCTGG - Intergenic
999188893 5:149731855-149731877 AAGCCCGCCACGCGGGAGGCAGG + Intronic
999459736 5:151747704-151747726 ATCCCAGCCACTCGGGAGGCTGG - Intronic
1000010269 5:157224661-157224683 ATTCCAGCTACTCGGGAGGCTGG + Intronic
1000902925 5:166930705-166930727 ATTCCAGCTACTCGGGAGGCTGG - Intergenic
1001403926 5:171462435-171462457 AATCCTGCTGCTGGGGAGGGAGG - Intergenic
1002455694 5:179344618-179344640 GACTCCGCCGCTCCGGAGGCTGG - Intronic
1003088576 6:3081740-3081762 ATTCCAGCTACTCGGGAGGCTGG + Intronic
1007519117 6:42438037-42438059 ATCCCAGCTGCTCGGGAGGCTGG - Intronic
1014392646 6:120882301-120882323 ATTCCAGCTACTCGGGAGGCTGG - Intergenic
1017764455 6:157595308-157595330 AGTCCAGCTACTCGGGAGGCTGG - Intronic
1017859070 6:158378600-158378622 ATTCCAGCTACTCGGGAGGCTGG - Intronic
1018188674 6:161289604-161289626 AATCCAGCTACTCGGGAGGCTGG + Intergenic
1018399876 6:163411987-163412009 ATCCCAGCTGCTCGGGAGGCTGG + Intergenic
1019839627 7:3427399-3427421 AATCCAGCTACTTGGGAGGCTGG + Intronic
1019991037 7:4691450-4691472 ACTCCAGCTACTCGGGAGGCTGG - Intronic
1020234943 7:6348326-6348348 GGTCCCGCAGCTCGGGAGGTGGG - Intronic
1024041351 7:45558465-45558487 ATTCCAGCTACTCGGGAGGCAGG - Intergenic
1025880900 7:65535434-65535456 AATCCCGGTACTGGGGAGGCTGG + Intergenic
1025892537 7:65667172-65667194 AATCCCGGTACTGGGGAGGCTGG - Intergenic
1029157986 7:98530867-98530889 AATCCCAGTACTCGGGAGGCTGG - Intergenic
1032132034 7:129237833-129237855 ATCCCAGCCACTCGGGAGGCTGG - Intronic
1032274270 7:130440828-130440850 ACTTCCGCCGCCCGGAAGGCGGG - Intronic
1034145959 7:148871825-148871847 AATCCCAGCACTTGGGAGGCTGG - Intronic
1038143104 8:24867608-24867630 AATCCCAGCACTTGGGAGGCAGG - Intergenic
1041231007 8:55752088-55752110 AATCCAGCTACTCAGGAGGCTGG + Intronic
1041822962 8:62060609-62060631 ATCCCAGCTGCTCGGGAGGCTGG + Intergenic
1045019857 8:98032647-98032669 ATTCCAGCTACTCGGGAGGCTGG - Intronic
1049100297 8:140574377-140574399 GTTCCGGCCGCTTGGGAGGCTGG - Intronic
1049321421 8:141998914-141998936 ATTCCCTCGGCTCTGGAGGCTGG + Intergenic
1053398821 9:37800289-37800311 ATCCCAGCTGCTCGGGAGGCTGG + Intronic
1054735781 9:68748737-68748759 AATCCCACTACTCAGGAGGCTGG - Intronic
1056600184 9:88041006-88041028 ATTCCAGCTACTCGGGAGGCTGG - Intergenic
1059207091 9:112477141-112477163 ATCCCAGCTGCTCGGGAGGCTGG - Intronic
1060250431 9:121982601-121982623 AATCCAGCTACTTGGGAGGCTGG + Intronic
1060652339 9:125339240-125339262 AATCCCAACACTTGGGAGGCTGG - Intronic
1062365138 9:136204818-136204840 AGTCCCGCCGCTCTGCAGGCGGG - Intronic
1185541413 X:905708-905730 AACCCAGCTACTCGGGAGGCTGG + Intergenic
1187318511 X:18220298-18220320 AATCTCGGCGCTCGCGACGCCGG - Intronic
1189549526 X:42078531-42078553 ATTCCAGCCACTCGGGAGGCTGG - Intergenic
1190332295 X:49243273-49243295 ACTCCCGTGGCTCTGGAGGCAGG - Exonic
1192176963 X:68892383-68892405 AAACCAGCCCCTGGGGAGGCTGG - Intergenic
1194718196 X:97310889-97310911 AATCGCGCTACTTGGGAGGCTGG + Intronic