ID: 990956375

View in Genome Browser
Species Human (GRCh38)
Location 5:61344236-61344258
Sequence AAGTGGTATTTGGGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990956375 Original CRISPR AAGTGGTATTTGGGGGAAGA AGG (reversed) Intronic
900742780 1:4340748-4340770 AGGTGGGACCTGGGGGAAGACGG + Intergenic
900742780 1:4340748-4340770 AGGTGGGACCTGGGGGAAGACGG + Intergenic
901791895 1:11658199-11658221 AAGGGGCATTTGGGAGAAGGCGG + Intronic
901791895 1:11658199-11658221 AAGGGGCATTTGGGAGAAGGCGG + Intronic
905017247 1:34786185-34786207 GAGTAGGATTTGGGGAAAGAGGG - Exonic
905017247 1:34786185-34786207 GAGTAGGATTTGGGGAAAGAGGG - Exonic
905148260 1:35904944-35904966 AACTAGTAGTTGGGGGATGATGG + Intronic
905148260 1:35904944-35904966 AACTAGTAGTTGGGGGATGATGG + Intronic
908830197 1:68170942-68170964 AAGAGTTATTTGGAGAAAGAAGG - Intronic
908830197 1:68170942-68170964 AAGAGTTATTTGGAGAAAGAAGG - Intronic
909225178 1:73010939-73010961 AGGTGGTAATAGGGGGAGGAGGG - Intergenic
909225178 1:73010939-73010961 AGGTGGTAATAGGGGGAGGAGGG - Intergenic
910907954 1:92201556-92201578 AAGTGGGATTTGGGGATGGATGG - Intergenic
910907954 1:92201556-92201578 AAGTGGGATTTGGGGATGGATGG - Intergenic
913487304 1:119343358-119343380 AAGAGAAAATTGGGGGAAGAAGG + Intergenic
913487304 1:119343358-119343380 AAGAGAAAATTGGGGGAAGAAGG + Intergenic
914431002 1:147620179-147620201 AACTGGTATTCGAGGGAAAATGG - Exonic
914431002 1:147620179-147620201 AACTGGTATTCGAGGGAAAATGG - Exonic
915612753 1:157007711-157007733 AGGTGGTATTTGTGTCAAGAAGG - Intronic
915612753 1:157007711-157007733 AGGTGGTATTTGTGTCAAGAAGG - Intronic
916098114 1:161369280-161369302 ATGAGGATTTTGGGGGAAGAAGG - Exonic
916098114 1:161369280-161369302 ATGAGGATTTTGGGGGAAGAAGG - Exonic
916299335 1:163256425-163256447 CAGTGGTGTTTGGAGGTAGAGGG + Intronic
916299335 1:163256425-163256447 CAGTGGTGTTTGGAGGTAGAGGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916997979 1:170322099-170322121 AAGTGGCATTTGGGGTTAAAGGG - Intergenic
916997979 1:170322099-170322121 AAGTGGCATTTGGGGTTAAAGGG - Intergenic
917151530 1:171950654-171950676 TAGTGGTTTTTGGTGGAGGATGG + Intronic
917151530 1:171950654-171950676 TAGTGGTTTTTGGTGGAGGATGG + Intronic
917193078 1:172439431-172439453 AAGTGGTAGCTGTGGGGAGAAGG - Intronic
917193078 1:172439431-172439453 AAGTGGTAGCTGTGGGGAGAAGG - Intronic
918867921 1:189927127-189927149 AAGTTGTGTGTGGGGGAATAGGG - Intergenic
918867921 1:189927127-189927149 AAGTTGTGTGTGGGGGAATAGGG - Intergenic
920303752 1:205005753-205005775 AAGTGGGATCTGGGGTAAGGTGG - Intronic
920303752 1:205005753-205005775 AAGTGGGATCTGGGGTAAGGTGG - Intronic
920494815 1:206447196-206447218 AAATACTATTTAGGGGAAGAAGG - Intronic
920494815 1:206447196-206447218 AAATACTATTTAGGGGAAGAAGG - Intronic
920817387 1:209347685-209347707 GAGTGGTATTTTGTTGAAGATGG - Intergenic
920817387 1:209347685-209347707 GAGTGGTATTTTGTTGAAGATGG - Intergenic
920865138 1:209745820-209745842 AAGGGGAATTTGGTAGAAGACGG - Intergenic
920865138 1:209745820-209745842 AAGGGGAATTTGGTAGAAGACGG - Intergenic
921066759 1:211628704-211628726 AAATGGCATTTGTGGGAAGGAGG - Intergenic
921066759 1:211628704-211628726 AAATGGCATTTGTGGGAAGGAGG - Intergenic
922194664 1:223349697-223349719 AAGTGGCAATTAGGTGAAGAAGG - Intronic
922194664 1:223349697-223349719 AAGTGGCAATTAGGTGAAGAAGG - Intronic
922308655 1:224367297-224367319 AAGTAGGGTTTGGAGGAAGATGG + Intronic
922308655 1:224367297-224367319 AAGTAGGGTTTGGAGGAAGATGG + Intronic
922416362 1:225426970-225426992 AACTGGTGTGTGGGAGAAGATGG - Intronic
922416362 1:225426970-225426992 AACTGGTGTGTGGGAGAAGATGG - Intronic
1063878598 10:10507672-10507694 GAGAGGAATTTGTGGGAAGATGG + Intergenic
1063878598 10:10507672-10507694 GAGAGGAATTTGTGGGAAGATGG + Intergenic
1064305776 10:14164616-14164638 ACGTGGTATTGGGAAGAAGATGG + Intronic
1064305776 10:14164616-14164638 ACGTGGTATTGGGAAGAAGATGG + Intronic
1065319459 10:24495627-24495649 AAGAGGACTTAGGGGGAAGAAGG + Intronic
1065319459 10:24495627-24495649 AAGAGGACTTAGGGGGAAGAAGG + Intronic
1065673304 10:28145894-28145916 AACTGGTATTTGGCTCAAGAGGG - Intronic
1065673304 10:28145894-28145916 AACTGGTATTTGGCTCAAGAGGG - Intronic
1066705044 10:38168360-38168382 ATTTGGTATTTGGGAGAAGAGGG + Intergenic
1066705044 10:38168360-38168382 ATTTGGTATTTGGGAGAAGAGGG + Intergenic
1066985440 10:42462194-42462216 ATTTGGTATTTGGGAGAAGAGGG - Intergenic
1066985440 10:42462194-42462216 ATTTGGTATTTGGGAGAAGAGGG - Intergenic
1069295472 10:66838503-66838525 AAGAGCTATGTTGGGGAAGATGG + Intronic
1069295472 10:66838503-66838525 AAGAGCTATGTTGGGGAAGATGG + Intronic
1069872143 10:71539772-71539794 AAGGGGTAAATGGGAGAAGATGG - Intronic
1069872143 10:71539772-71539794 AAGGGGTAAATGGGAGAAGATGG - Intronic
1070027490 10:72646095-72646117 AAGTGGGATTTGGGAAAAAAAGG - Intergenic
1070027490 10:72646095-72646117 AAGTGGGATTTGGGAAAAAAAGG - Intergenic
1070195606 10:74153551-74153573 ACGTGGGATTAGGGGAAAGAAGG + Intronic
1070195606 10:74153551-74153573 ACGTGGGATTAGGGGAAAGAAGG + Intronic
1070352180 10:75603211-75603233 AAGTGGATTTCGGGTGAAGAAGG + Intronic
1070352180 10:75603211-75603233 AAGTGGATTTCGGGTGAAGAAGG + Intronic
1071940689 10:90588315-90588337 AAGTGGTGTCTGGGAGAAGTTGG - Intergenic
1071940689 10:90588315-90588337 AAGTGGTGTCTGGGAGAAGTTGG - Intergenic
1073324907 10:102636988-102637010 TAGGGCTATCTGGGGGAAGATGG + Intergenic
1073324907 10:102636988-102637010 TAGGGCTATCTGGGGGAAGATGG + Intergenic
1074040303 10:109781616-109781638 AAGGGCTAGTTGGGGGAAAATGG - Intergenic
1074040303 10:109781616-109781638 AAGGGCTAGTTGGGGGAAAATGG - Intergenic
1074391569 10:113062565-113062587 AGGTGGTGTGTGGGGGAAGGGGG - Intronic
1074391569 10:113062565-113062587 AGGTGGTGTGTGGGGGAAGGGGG - Intronic
1074584844 10:114757871-114757893 GAGAGGTAGTTGGGGGAAGGAGG - Intergenic
1074584844 10:114757871-114757893 GAGAGGTAGTTGGGGGAAGGAGG - Intergenic
1076066873 10:127455759-127455781 AAGTGGTATTTGGCAGAAACAGG + Intergenic
1076066873 10:127455759-127455781 AAGTGGTATTTGGCAGAAACAGG + Intergenic
1076234622 10:128853827-128853849 ATGTGGTAGTTGGGGGAATATGG + Intergenic
1076234622 10:128853827-128853849 ATGTGGTAGTTGGGGGAATATGG + Intergenic
1076297087 10:129394594-129394616 AGGTGGCAATTGTGGGAAGAGGG - Intergenic
1076297087 10:129394594-129394616 AGGTGGCAATTGTGGGAAGAGGG - Intergenic
1076939006 10:133588633-133588655 ATGTGGTATTTGTGTAAAGATGG + Intergenic
1076939006 10:133588633-133588655 ATGTGGTATTTGTGTAAAGATGG + Intergenic
1076979945 11:198908-198930 ATGAGCTATTTGGGGGAGGAGGG + Intronic
1076979945 11:198908-198930 ATGAGCTATTTGGGGGAGGAGGG + Intronic
1079329058 11:19519221-19519243 AGTTGGTATTTGGTGGTAGAAGG - Intronic
1079329058 11:19519221-19519243 AGTTGGTATTTGGTGGTAGAAGG - Intronic
1080255102 11:30281947-30281969 TAGAGGTACTTGGAGGAAGATGG - Intergenic
1080255102 11:30281947-30281969 TAGAGGTACTTGGAGGAAGATGG - Intergenic
1080524631 11:33102434-33102456 AAGTGGTATTTGGAAAAAGTAGG - Intronic
1080524631 11:33102434-33102456 AAGTGGTATTTGGAAAAAGTAGG - Intronic
1083710426 11:64545064-64545086 AAGTGGTGTTTGGTGGAGGGAGG + Intergenic
1083710426 11:64545064-64545086 AAGTGGTGTTTGGTGGAGGGAGG + Intergenic
1085264564 11:75229625-75229647 AAGGGGTATTGAGGAGAAGAGGG - Intergenic
1085264564 11:75229625-75229647 AAGGGGTATTGAGGAGAAGAGGG - Intergenic
1086209837 11:84306726-84306748 TACTGGGATTTAGGGGAAGAGGG - Intronic
1086209837 11:84306726-84306748 TACTGGGATTTAGGGGAAGAGGG - Intronic
1087318067 11:96627913-96627935 AAGAGGAATTTTGGGAAAGATGG + Intergenic
1087318067 11:96627913-96627935 AAGAGGAATTTTGGGAAAGATGG + Intergenic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1089811863 11:121138642-121138664 AAGTGCTCTTTGGGTGAAAAGGG - Intronic
1089811863 11:121138642-121138664 AAGTGCTCTTTGGGTGAAAAGGG - Intronic
1091102212 11:132885585-132885607 AGTTGGTATTTGGGGTAAAAGGG + Intronic
1091102212 11:132885585-132885607 AGTTGGTATTTGGGGTAAAAGGG + Intronic
1091409590 12:230257-230279 AAGAGGTCTTGGGGGGAAGGAGG + Intronic
1091409590 12:230257-230279 AAGAGGTCTTGGGGGGAAGGAGG + Intronic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1093423768 12:19004432-19004454 AAGTGGAACTAGGGCGAAGAGGG - Intergenic
1093423768 12:19004432-19004454 AAGTGGAACTAGGGCGAAGAGGG - Intergenic
1093653482 12:21670678-21670700 AAGTGGCACTTGGGAGAAGCTGG - Intronic
1093653482 12:21670678-21670700 AAGTGGCACTTGGGAGAAGCTGG - Intronic
1094579424 12:31720573-31720595 AATTGGTATTTGTGAGAAAAAGG - Intronic
1094579424 12:31720573-31720595 AATTGGTATTTGTGAGAAAAAGG - Intronic
1095656885 12:44680792-44680814 AACTGCGATTTGGGGGAAGCAGG - Intronic
1095656885 12:44680792-44680814 AACTGCGATTTGGGGGAAGCAGG - Intronic
1095679606 12:44958750-44958772 CACAGGTATCTGGGGGAAGATGG + Intergenic
1095679606 12:44958750-44958772 CACAGGTATCTGGGGGAAGATGG + Intergenic
1096490863 12:52012243-52012265 AAGTGGCATTTGGGCCATGAAGG - Intronic
1096490863 12:52012243-52012265 AAGTGGCATTTGGGCCATGAAGG - Intronic
1097997398 12:65903960-65903982 ATGTTTTATTTGGGGGAAGTGGG + Intronic
1097997398 12:65903960-65903982 ATGTTTTATTTGGGGGAAGTGGG + Intronic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1098967995 12:76814272-76814294 AAGTAGTAGTGGGGGAAAGATGG + Intronic
1098967995 12:76814272-76814294 AAGTAGTAGTGGGGGAAAGATGG + Intronic
1099346204 12:81503089-81503111 AAGTGTTATTTATGGGAAGTGGG - Intronic
1099346204 12:81503089-81503111 AAGTGTTATTTATGGGAAGTGGG - Intronic
1099833678 12:87878816-87878838 AAGAGGTAATTAGGTGAAGAGGG - Intergenic
1099833678 12:87878816-87878838 AAGAGGTAATTAGGTGAAGAGGG - Intergenic
1102751148 12:115295842-115295864 AAGTAGAGTTTGGGGAAAGATGG - Intergenic
1102751148 12:115295842-115295864 AAGTAGAGTTTGGGGAAAGATGG - Intergenic
1104300611 12:127561821-127561843 AGGTGGCATTTGAGTGAAGATGG + Intergenic
1104300611 12:127561821-127561843 AGGTGGCATTTGAGTGAAGATGG + Intergenic
1104428839 12:128699908-128699930 AAGTCTTCTTTGGGGGCAGATGG + Intronic
1104428839 12:128699908-128699930 AAGTCTTCTTTGGGGGCAGATGG + Intronic
1107169819 13:37327501-37327523 ATGTGGAATATGGGGGAAGATGG + Intergenic
1107169819 13:37327501-37327523 ATGTGGAATATGGGGGAAGATGG + Intergenic
1107661761 13:42646228-42646250 AATTGGTAGTTGTGGGGAGAGGG - Intergenic
1107661761 13:42646228-42646250 AATTGGTAGTTGTGGGGAGAGGG - Intergenic
1107662669 13:42655569-42655591 AAGTGGCATGAGGTGGAAGATGG - Intergenic
1107662669 13:42655569-42655591 AAGTGGCATGAGGTGGAAGATGG - Intergenic
1107795722 13:44049530-44049552 AAGGGTTATTTGGGCCAAGAGGG + Intergenic
1107795722 13:44049530-44049552 AAGGGTTATTTGGGCCAAGAGGG + Intergenic
1107850421 13:44566916-44566938 AAGTGGGATGTGGGGGGAGAAGG + Intronic
1107850421 13:44566916-44566938 AAGTGGGATGTGGGGGGAGAAGG + Intronic
1110579830 13:77109010-77109032 AAGTACTATTTGGAGAAAGAAGG + Intronic
1110579830 13:77109010-77109032 AAGTACTATTTGGAGAAAGAAGG + Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112707790 13:102091549-102091571 GGCTGGTATTTGAGGGAAGAAGG - Intronic
1112707790 13:102091549-102091571 GGCTGGTATTTGAGGGAAGAAGG - Intronic
1112891675 13:104241460-104241482 AAGGGAAATTTGGGAGAAGAGGG + Intergenic
1112891675 13:104241460-104241482 AAGGGAAATTTGGGAGAAGAGGG + Intergenic
1113904827 13:113814365-113814387 ATGTTGTGTTTGGGGGAAGCTGG - Exonic
1113904827 13:113814365-113814387 ATGTTGTGTTTGGGGGAAGCTGG - Exonic
1114838364 14:26232079-26232101 ATTTGGTGTTTGGTGGAAGATGG - Intergenic
1114838364 14:26232079-26232101 ATTTGGTGTTTGGTGGAAGATGG - Intergenic
1116497286 14:45576773-45576795 GAAGGGTAGTTGGGGGAAGAAGG - Intergenic
1116497286 14:45576773-45576795 GAAGGGTAGTTGGGGGAAGAAGG - Intergenic
1118024536 14:61755597-61755619 TACTGGGATTTGGGAGAAGAAGG - Intergenic
1118024536 14:61755597-61755619 TACTGGGATTTGGGAGAAGAAGG - Intergenic
1119330305 14:73788294-73788316 AAGCAGTATTTGGGGAAAAAAGG - Intronic
1119330305 14:73788294-73788316 AAGCAGTATTTGGGGAAAAAAGG - Intronic
1119814439 14:77552950-77552972 AACTGTTATTTAGGGGTAGAAGG - Intronic
1119814439 14:77552950-77552972 AACTGTTATTTAGGGGTAGAAGG - Intronic
1119955669 14:78796274-78796296 AAGTGGGAATTTGGGAAAGATGG - Intronic
1119955669 14:78796274-78796296 AAGTGGGAATTTGGGAAAGATGG - Intronic
1119965824 14:78914520-78914542 AGGTGGCATTTGAGGAAAGATGG + Intronic
1119965824 14:78914520-78914542 AGGTGGCATTTGAGGAAAGATGG + Intronic
1120622447 14:86780916-86780938 AAGTGGGACTTGGATGAAGAAGG - Intergenic
1120622447 14:86780916-86780938 AAGTGGGACTTGGATGAAGAAGG - Intergenic
1120647236 14:87088626-87088648 AAGTGGGAAGTGGGGGAAGTTGG + Intergenic
1120647236 14:87088626-87088648 AAGTGGGAAGTGGGGGAAGTTGG + Intergenic
1120667919 14:87329236-87329258 AAGTTAGATTTGGGGAAAGATGG - Intergenic
1120667919 14:87329236-87329258 AAGTTAGATTTGGGGAAAGATGG - Intergenic
1121315167 14:92957052-92957074 AAGAGGCATCTAGGGGAAGAAGG + Intronic
1121315167 14:92957052-92957074 AAGAGGCATCTAGGGGAAGAAGG + Intronic
1121509373 14:94501002-94501024 AAGTGGTTTTTGGGGGTAGAAGG - Intronic
1121509373 14:94501002-94501024 AAGTGGTTTTTGGGGGTAGAAGG - Intronic
1202835858 14_GL000009v2_random:76951-76973 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1202835858 14_GL000009v2_random:76951-76973 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1124148059 15:27149028-27149050 AAGTCGTATTTTTGGAAAGAAGG + Intronic
1124148059 15:27149028-27149050 AAGTCGTATTTTTGGAAAGAAGG + Intronic
1125271298 15:37941454-37941476 AGGTGGAATTTGGGGGCAGTTGG - Intronic
1125271298 15:37941454-37941476 AGGTGGAATTTGGGGGCAGTTGG - Intronic
1125634147 15:41173067-41173089 AAGGGGAAAGTGGGGGAAGAAGG - Intergenic
1125634147 15:41173067-41173089 AAGGGGAAAGTGGGGGAAGAAGG - Intergenic
1126019135 15:44382699-44382721 AACTGATATTTGGGTAAAGAAGG + Intronic
1126019135 15:44382699-44382721 AACTGATATTTGGGTAAAGAAGG + Intronic
1128065761 15:64763515-64763537 ACATGGGATTTGGGGCAAGAGGG - Intronic
1128065761 15:64763515-64763537 ACATGGGATTTGGGGCAAGAGGG - Intronic
1128917175 15:71573553-71573575 AGGTGGCATTTGAGGGAAAAAGG - Intronic
1128917175 15:71573553-71573575 AGGTGGCATTTGAGGGAAAAAGG - Intronic
1128986276 15:72224048-72224070 GAGTGGTCTTTGAGGGAAGTAGG - Intronic
1128986276 15:72224048-72224070 GAGTGGTCTTTGAGGGAAGTAGG - Intronic
1131184337 15:90262437-90262459 AAATGGTGTTGGGGAGAAGAGGG - Intronic
1131184337 15:90262437-90262459 AAATGGTGTTGGGGAGAAGAGGG - Intronic
1131459515 15:92608575-92608597 AATTTCTATTTGGAGGAAGAGGG - Intergenic
1131459515 15:92608575-92608597 AATTTCTATTTGGAGGAAGAGGG - Intergenic
1131690313 15:94820275-94820297 AAGGGGTATTGTGGGGAATATGG - Intergenic
1131690313 15:94820275-94820297 AAGGGGTATTGTGGGGAATATGG - Intergenic
1132136176 15:99341653-99341675 AATTGATATTTGGGAGAACAGGG - Intronic
1132136176 15:99341653-99341675 AATTGATATTTGGGAGAACAGGG - Intronic
1133106545 16:3513932-3513954 AAGTGGAAGTCTGGGGAAGAGGG + Intronic
1133106545 16:3513932-3513954 AAGTGGAAGTCTGGGGAAGAGGG + Intronic
1133911634 16:10071485-10071507 CAGTGTTATTAGGGTGAAGAAGG - Intronic
1133911634 16:10071485-10071507 CAGTGTTATTAGGGTGAAGAAGG - Intronic
1133925441 16:10188357-10188379 AATTGGGATTGGGGTGAAGAGGG + Intergenic
1133925441 16:10188357-10188379 AATTGGGATTGGGGTGAAGAGGG + Intergenic
1134622715 16:15701447-15701469 GAGGGGTCTTTGGGGCAAGATGG + Intronic
1134622715 16:15701447-15701469 GAGGGGTCTTTGGGGCAAGATGG + Intronic
1135088861 16:19496374-19496396 AAGTGGTATTTGCGTTAAGGTGG - Intronic
1135088861 16:19496374-19496396 AAGTGGTATTTGCGTTAAGGTGG - Intronic
1135325965 16:21526101-21526123 AAAAGGGATTTGAGGGAAGAGGG + Intergenic
1135325965 16:21526101-21526123 AAAAGGGATTTGAGGGAAGAGGG + Intergenic
1138678626 16:58669567-58669589 GAGTGGGTTGTGGGGGAAGAGGG + Intronic
1138678626 16:58669567-58669589 GAGTGGGTTGTGGGGGAAGAGGG + Intronic
1138687590 16:58739142-58739164 ATGTGGTATGTGGAGGAGGAAGG + Intergenic
1138687590 16:58739142-58739164 ATGTGGTATGTGGAGGAGGAAGG + Intergenic
1139394471 16:66629622-66629644 AAGTGACTTTTGTGGGAAGAGGG + Intronic
1139394471 16:66629622-66629644 AAGTGACTTTTGTGGGAAGAGGG + Intronic
1139499877 16:67354144-67354166 AAGGACTATTTGGGGGAGGAAGG - Intronic
1139499877 16:67354144-67354166 AAGGACTATTTGGGGGAGGAAGG - Intronic
1140158833 16:72463017-72463039 AAATGGTATTTGTAGGTAGAAGG + Intergenic
1140158833 16:72463017-72463039 AAATGGTATTTGTAGGTAGAAGG + Intergenic
1140714756 16:77712351-77712373 AAGTGGTAATTGGGGGGGGCGGG - Intergenic
1140714756 16:77712351-77712373 AAGTGGTAATTGGGGGGGGCGGG - Intergenic
1140805904 16:78532039-78532061 AAGTGGTATTTGGGGGAGTAGGG + Intronic
1140805904 16:78532039-78532061 AAGTGGTATTTGGGGGAGTAGGG + Intronic
1140973477 16:80036325-80036347 AGCTGGTAGTTAGGGGAAGAAGG + Intergenic
1140973477 16:80036325-80036347 AGCTGGTAGTTAGGGGAAGAAGG + Intergenic
1142039001 16:87880792-87880814 AAAATGGATTTGGGGGAAGAGGG + Intergenic
1142039001 16:87880792-87880814 AAAATGGATTTGGGGGAAGAGGG + Intergenic
1143756214 17:9069661-9069683 AACTGGGATTTGGGGACAGAAGG + Intronic
1143756214 17:9069661-9069683 AACTGGGATTTGGGGACAGAAGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144459475 17:15446471-15446493 AATTGGTCTTTCGGGAAAGAAGG + Intronic
1144459475 17:15446471-15446493 AATTGGTCTTTCGGGAAAGAAGG + Intronic
1145107224 17:20128710-20128732 AAGTAGAACTTGGGGGAAGCTGG - Intronic
1145107224 17:20128710-20128732 AAGTAGAACTTGGGGGAAGCTGG - Intronic
1146206461 17:30909169-30909191 AGCTAGTTTTTGGGGGAAGACGG - Intronic
1146206461 17:30909169-30909191 AGCTAGTTTTTGGGGGAAGACGG - Intronic
1146755237 17:35425431-35425453 TAGTGGTTACTGGGGGAAGATGG - Intronic
1146755237 17:35425431-35425453 TAGTGGTTACTGGGGGAAGATGG - Intronic
1147856226 17:43482521-43482543 AGCTGATATTTGGGGGAATAAGG + Intergenic
1147856226 17:43482521-43482543 AGCTGATATTTGGGGGAATAAGG + Intergenic
1148283386 17:46366963-46366985 TAGTGGCACTTGGGGGAAGGTGG - Intergenic
1148283386 17:46366963-46366985 TAGTGGCACTTGGGGGAAGGTGG - Intergenic
1148305604 17:46584884-46584906 TAGTGGCACTTGGGGGAAGGTGG - Intergenic
1148305604 17:46584884-46584906 TAGTGGCACTTGGGGGAAGGTGG - Intergenic
1148606449 17:48932785-48932807 GATGGGGATTTGGGGGAAGATGG + Intronic
1148606449 17:48932785-48932807 GATGGGGATTTGGGGGAAGATGG + Intronic
1148794961 17:50192533-50192555 AGGTGGGAAATGGGGGAAGAAGG + Intronic
1148794961 17:50192533-50192555 AGGTGGGAAATGGGGGAAGAAGG + Intronic
1148920294 17:51025597-51025619 AAGTGGTATTTGGCTGGACACGG + Intronic
1148920294 17:51025597-51025619 AAGTGGTATTTGGCTGGACACGG + Intronic
1149342429 17:55700538-55700560 AAGTGGTTTGGGGTGGAAGATGG - Intergenic
1149342429 17:55700538-55700560 AAGTGGTTTGGGGTGGAAGATGG - Intergenic
1149386639 17:56149219-56149241 AAGTGGTGTTTGGGGCAAGTGGG + Intronic
1149386639 17:56149219-56149241 AAGTGGTGTTTGGGGCAAGTGGG + Intronic
1149719861 17:58832691-58832713 AAGATGTCTTTGGGGGAAGCTGG - Intronic
1149719861 17:58832691-58832713 AAGATGTCTTTGGGGGAAGCTGG - Intronic
1150026333 17:61678481-61678503 GAGTGGAATTTGGTGTAAGATGG + Intergenic
1150026333 17:61678481-61678503 GAGTGGAATTTGGTGTAAGATGG + Intergenic
1150508592 17:65724974-65724996 AGGAGGTATTTGGGGCAGGAAGG - Intronic
1150508592 17:65724974-65724996 AGGAGGTATTTGGGGCAGGAAGG - Intronic
1151127629 17:71862122-71862144 ATCTGGTATCTGGTGGAAGAGGG - Intergenic
1151127629 17:71862122-71862144 ATCTGGTATCTGGTGGAAGAGGG - Intergenic
1151265438 17:72951810-72951832 GAGAGGTCTTTGTGGGAAGATGG + Intronic
1151265438 17:72951810-72951832 GAGAGGTCTTTGTGGGAAGATGG + Intronic
1152274612 17:79349039-79349061 GAGTTGAATTTGTGGGAAGAGGG - Intronic
1152274612 17:79349039-79349061 GAGTTGAATTTGTGGGAAGAGGG - Intronic
1157417737 18:47520210-47520232 GAGAGGCATTTGGGGGAACATGG + Intergenic
1157417737 18:47520210-47520232 GAGAGGCATTTGGGGGAACATGG + Intergenic
1157549211 18:48569679-48569701 AACTGGTCTTTGGAGGAGGAGGG - Intronic
1157549211 18:48569679-48569701 AACTGGTCTTTGGAGGAGGAGGG - Intronic
1159609575 18:70510843-70510865 AAGTGGAATTTGGGTGAATTTGG - Intergenic
1159609575 18:70510843-70510865 AAGTGGAATTTGGGTGAATTTGG - Intergenic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1160105801 18:75974903-75974925 AAATGGAAGTTGGGGGAGGAAGG - Intergenic
1160105801 18:75974903-75974925 AAATGGAAGTTGGGGGAGGAAGG - Intergenic
1160319292 18:77875211-77875233 GAGGGGTGTTTGGGGGAAGGAGG - Intergenic
1160319292 18:77875211-77875233 GAGGGGTGTTTGGGGGAAGGAGG - Intergenic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1164491512 19:28719259-28719281 AAAGGGTAGTTGGGGGATGAGGG + Intergenic
1164491512 19:28719259-28719281 AAAGGGTAGTTGGGGGATGAGGG + Intergenic
1164687666 19:30178822-30178844 CAGGGGTCTTTGGGGGAAGCAGG + Intergenic
1164687666 19:30178822-30178844 CAGGGGTCTTTGGGGGAAGCAGG + Intergenic
1164943576 19:32270665-32270687 AAGTGTTATGTTGGGGAAGAAGG - Intergenic
1164943576 19:32270665-32270687 AAGTGTTATGTTGGGGAAGAAGG - Intergenic
1165125774 19:33596072-33596094 AAGTGATTTTTGGGGAATGATGG - Intergenic
1165125774 19:33596072-33596094 AAGTGATTTTTGGGGAATGATGG - Intergenic
1165531541 19:36406358-36406380 TAGGGATATTTGGGGGATGACGG - Intronic
1165531541 19:36406358-36406380 TAGGGATATTTGGGGGATGACGG - Intronic
1166262785 19:41652990-41653012 AAAAGGTATTTGTGGGAAGATGG + Intronic
1166262785 19:41652990-41653012 AAAAGGTATTTGTGGGAAGATGG + Intronic
1167455101 19:49593674-49593696 AGGTGGGATTTGGGGGCTGATGG - Intronic
1167455101 19:49593674-49593696 AGGTGGGATTTGGGGGCTGATGG - Intronic
1202636779 1_KI270706v1_random:50412-50434 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
1202636779 1_KI270706v1_random:50412-50434 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
926705790 2:15836551-15836573 AAGGGGTCTTTGGGGGCCGATGG - Intergenic
926705790 2:15836551-15836573 AAGGGGTCTTTGGGGGCCGATGG - Intergenic
928260296 2:29760728-29760750 AATTTTTATTTGGGGGTAGAGGG + Intronic
928260296 2:29760728-29760750 AATTTTTATTTGGGGGTAGAGGG + Intronic
928924192 2:36560391-36560413 ATGTCATTTTTGGGGGAAGAAGG - Intronic
928924192 2:36560391-36560413 ATGTCATTTTTGGGGGAAGAAGG - Intronic
929212887 2:39377848-39377870 AACTGATAATTGGGGGAGGAAGG - Intronic
929212887 2:39377848-39377870 AACTGATAATTGGGGGAGGAAGG - Intronic
929911079 2:46089860-46089882 CAATGGTATTTGGGGGATAATGG - Intronic
929911079 2:46089860-46089882 CAATGGTATTTGGGGGATAATGG - Intronic
930744698 2:54870284-54870306 AAGTTGTATTTGGGGGAAAAAGG + Intronic
930744698 2:54870284-54870306 AAGTTGTATTTGGGGGAAAAAGG + Intronic
930744719 2:54870407-54870429 AAGGTATATTTGGGGGAAAAAGG + Intronic
930744719 2:54870407-54870429 AAGGTATATTTGGGGGAAAAAGG + Intronic
931592323 2:63898591-63898613 AAATGGTATTTGGGAGCAGAGGG - Intronic
931592323 2:63898591-63898613 AAATGGTATTTGGGAGCAGAGGG - Intronic
932091477 2:68809688-68809710 AAGGGGTATTTGGGAGAGCAAGG + Intronic
932091477 2:68809688-68809710 AAGGGGTATTTGGGAGAGCAAGG + Intronic
932176430 2:69607127-69607149 GAGTGTTATGTGGGGGAAGAGGG + Intronic
932176430 2:69607127-69607149 GAGTGTTATGTGGGGGAAGAGGG + Intronic
932335738 2:70930486-70930508 AGGTGGCTGTTGGGGGAAGAGGG - Intronic
932335738 2:70930486-70930508 AGGTGGCTGTTGGGGGAAGAGGG - Intronic
933452903 2:82479409-82479431 AAAGGGTAGTTGGGGGAAGTGGG + Intergenic
933452903 2:82479409-82479431 AAAGGGTAGTTGGGGGAAGTGGG + Intergenic
933745024 2:85564272-85564294 AAGTGGAGTTGGGGGGAGGAAGG + Intronic
933745024 2:85564272-85564294 AAGTGGAGTTGGGGGGAGGAAGG + Intronic
934990413 2:98916363-98916385 ATGAGGAATTTTGGGGAAGATGG + Intronic
934990413 2:98916363-98916385 ATGAGGAATTTTGGGGAAGATGG + Intronic
935394079 2:102586979-102587001 AAGGGTTTTTTGGGGAAAGAGGG + Intergenic
935394079 2:102586979-102587001 AAGGGTTTTTTGGGGAAAGAGGG + Intergenic
935396033 2:102610245-102610267 GAGTGGTATATGGTGGAACATGG - Intergenic
935396033 2:102610245-102610267 GAGTGGTATATGGTGGAACATGG - Intergenic
936830545 2:116640507-116640529 AAGTGGCATCTTTGGGAAGATGG - Intergenic
936830545 2:116640507-116640529 AAGTGGCATCTTTGGGAAGATGG - Intergenic
936996129 2:118416242-118416264 AGGTGGGATTTGGAGGAAGACGG + Intergenic
936996129 2:118416242-118416264 AGGTGGGATTTGGAGGAAGACGG + Intergenic
937271089 2:120653386-120653408 AAAAGGTATTTGGGGGCATAGGG + Intergenic
937271089 2:120653386-120653408 AAAAGGTATTTGGGGGCATAGGG + Intergenic
937539821 2:122935372-122935394 AAGTTTTATTTGGGAGAAAAAGG + Intergenic
937539821 2:122935372-122935394 AAGTTTTATTTGGGAGAAAAAGG + Intergenic
937589752 2:123598642-123598664 AGGTGGTAATTGGAGGAAGGGGG + Intergenic
937589752 2:123598642-123598664 AGGTGGTAATTGGAGGAAGGGGG + Intergenic
938115494 2:128600518-128600540 AAGAAGTGTTTGGGGGAAGAAGG + Intergenic
938115494 2:128600518-128600540 AAGAAGTGTTTGGGGGAAGAAGG + Intergenic
939397282 2:141647071-141647093 AAGTTGTGGGTGGGGGAAGAAGG + Intronic
939397282 2:141647071-141647093 AAGTTGTGGGTGGGGGAAGAAGG + Intronic
941482101 2:166028944-166028966 AAGTGACATTTGGGACAAGAAGG + Intronic
941482101 2:166028944-166028966 AAGTGACATTTGGGACAAGAAGG + Intronic
941814113 2:169783449-169783471 AAATGCAATTTGGGGAAAGAGGG + Intergenic
941814113 2:169783449-169783471 AAATGCAATTTGGGGAAAGAGGG + Intergenic
944164421 2:196703039-196703061 AAGAGGTATTTGGGTAATGAGGG - Intronic
944164421 2:196703039-196703061 AAGAGGTATTTGGGTAATGAGGG - Intronic
944837949 2:203598226-203598248 AAATGTTGTTTGGGAGAAGAAGG - Intergenic
944837949 2:203598226-203598248 AAATGTTGTTTGGGAGAAGAAGG - Intergenic
944974602 2:205034313-205034335 AAGTGATATCTGGGAGAACAGGG - Intronic
944974602 2:205034313-205034335 AAGTGATATCTGGGAGAACAGGG - Intronic
945125477 2:206505069-206505091 AAGTGGCCTATAGGGGAAGAAGG + Intronic
945125477 2:206505069-206505091 AAGTGGCCTATAGGGGAAGAAGG + Intronic
946002237 2:216492288-216492310 AAATGGAATTTGAGGGGAGAAGG + Intergenic
946002237 2:216492288-216492310 AAATGGAATTTGAGGGGAGAAGG + Intergenic
946465693 2:219910025-219910047 ATGTGGTATTTGGATGGAGAAGG + Intergenic
946465693 2:219910025-219910047 ATGTGGTATTTGGATGGAGAAGG + Intergenic
946658549 2:221975506-221975528 AAGGTGTGGTTGGGGGAAGATGG - Intergenic
946658549 2:221975506-221975528 AAGGTGTGGTTGGGGGAAGATGG - Intergenic
947791767 2:232872775-232872797 AGGATGGATTTGGGGGAAGATGG + Intronic
947791767 2:232872775-232872797 AGGATGGATTTGGGGGAAGATGG + Intronic
947809225 2:232990589-232990611 TAATGATATTTGGGAGAAGAAGG - Intronic
947809225 2:232990589-232990611 TAATGATATTTGGGAGAAGAAGG - Intronic
1169434053 20:5569130-5569152 AAATGGTATTAGGAGAAAGAAGG - Intronic
1169434053 20:5569130-5569152 AAATGGTATTAGGAGAAAGAAGG - Intronic
1169544725 20:6638677-6638699 TAGTGATCTTTGGGGCAAGATGG + Intergenic
1169544725 20:6638677-6638699 TAGTGATCTTTGGGGCAAGATGG + Intergenic
1170879965 20:20288314-20288336 GAGTGGTTTTCGGCGGAAGAGGG - Intronic
1170879965 20:20288314-20288336 GAGTGGTTTTCGGCGGAAGAGGG - Intronic
1171221538 20:23402495-23402517 AAGTGGGGTTTGGGGGGAGGGGG - Intronic
1171221538 20:23402495-23402517 AAGTGGGGTTTGGGGGGAGGGGG - Intronic
1171284346 20:23924861-23924883 GAGTGGAATGTGGGGGAAGAGGG + Intergenic
1171284346 20:23924861-23924883 GAGTGGAATGTGGGGGAAGAGGG + Intergenic
1171880892 20:30616828-30616850 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
1171880892 20:30616828-30616850 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
1172296904 20:33818630-33818652 ATGTGGGATTTGGGGACAGAAGG + Intronic
1172296904 20:33818630-33818652 ATGTGGGATTTGGGGACAGAAGG + Intronic
1173702829 20:45088182-45088204 TAGAGGTATTTGTGGGAAGGAGG - Intergenic
1173702829 20:45088182-45088204 TAGAGGTATTTGTGGGAAGGAGG - Intergenic
1174389969 20:50213062-50213084 AATTGGGGTTTGGGGGAGGAGGG - Intergenic
1174389969 20:50213062-50213084 AATTGGGGTTTGGGGGAGGAGGG - Intergenic
1174720506 20:52806859-52806881 ACATGGTATTTGGGTGAACAAGG + Intergenic
1174720506 20:52806859-52806881 ACATGGTATTTGGGTGAACAAGG + Intergenic
1175132287 20:56798350-56798372 AAGGGGTATTTTGGAGATGATGG + Intergenic
1175132287 20:56798350-56798372 AAGGGGTATTTTGGAGATGATGG + Intergenic
1175427135 20:58875458-58875480 AAGAGGCATTGGGGGGAACAGGG + Intronic
1175427135 20:58875458-58875480 AAGAGGCATTGGGGGGAACAGGG + Intronic
1175535280 20:59706640-59706662 AGCTGGTAATTGGGGAAAGAAGG + Intronic
1175535280 20:59706640-59706662 AGCTGGTAATTGGGGAAAGAAGG + Intronic
1178776346 21:35554613-35554635 AAGAGGGATTTGTGGGAAAATGG - Intronic
1178776346 21:35554613-35554635 AAGAGGGATTTGTGGGAAAATGG - Intronic
1180364092 22:11923901-11923923 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1180364092 22:11923901-11923923 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1183109851 22:35641059-35641081 AAGCAGTTTTTGGGGCAAGAGGG - Intergenic
1183109851 22:35641059-35641081 AAGCAGTTTTTGGGGCAAGAGGG - Intergenic
1185417333 22:50717412-50717434 AGGTGGGATTGTGGGGAAGAAGG + Intergenic
1185417333 22:50717412-50717434 AGGTGGGATTGTGGGGAAGAAGG + Intergenic
950877342 3:16288226-16288248 ATGTGGTACTTTGGAGAAGAGGG + Intronic
950877342 3:16288226-16288248 ATGTGGTACTTTGGAGAAGAGGG + Intronic
951630699 3:24716727-24716749 AGGTGGGATTGGGGGGAGGAAGG + Intergenic
951630699 3:24716727-24716749 AGGTGGGATTGGGGGGAGGAAGG + Intergenic
954205589 3:49056722-49056744 ATTTAGTATTTGGGAGAAGAGGG - Intronic
954205589 3:49056722-49056744 ATTTAGTATTTGGGAGAAGAGGG - Intronic
955113271 3:55971435-55971457 GAGTGGTTTATTGGGGAAGATGG - Intronic
955113271 3:55971435-55971457 GAGTGGTTTATTGGGGAAGATGG - Intronic
956712137 3:72048258-72048280 AAGTGGTTTATTTGGGAAGAAGG + Intergenic
956712137 3:72048258-72048280 AAGTGGTTTATTTGGGAAGAAGG + Intergenic
957688099 3:83530304-83530326 ATGTGGTGTTTGGGGGTAGGGGG - Intergenic
957688099 3:83530304-83530326 ATGTGGTGTTTGGGGGTAGGGGG - Intergenic
957697716 3:83663681-83663703 AAGTGACATTTTGTGGAAGAGGG + Intergenic
957697716 3:83663681-83663703 AAGTGACATTTTGTGGAAGAGGG + Intergenic
960781969 3:121329851-121329873 AAGAGGAATGTGGGGGAACAGGG - Intronic
960781969 3:121329851-121329873 AAGAGGAATGTGGGGGAACAGGG - Intronic
961032515 3:123618941-123618963 AAATGGTTTTTGGCAGAAGAAGG + Intronic
961032515 3:123618941-123618963 AAATGGTTTTTGGCAGAAGAAGG + Intronic
963334347 3:143955834-143955856 AAGAGGTAATTGGGCGATGAGGG - Intergenic
963334347 3:143955834-143955856 AAGAGGTAATTGGGCGATGAGGG - Intergenic
963564489 3:146911171-146911193 AAATTGTCTTTGGGGGAAAAGGG + Intergenic
963564489 3:146911171-146911193 AAATTGTCTTTGGGGGAAAAGGG + Intergenic
965630430 3:170727033-170727055 AAGTGGGAGTTGGGAGAATAGGG - Intronic
965630430 3:170727033-170727055 AAGTGGGAGTTGGGAGAATAGGG - Intronic
966911110 3:184560871-184560893 AAGTAGGTGTTGGGGGAAGAAGG - Intronic
966911110 3:184560871-184560893 AAGTAGGTGTTGGGGGAAGAAGG - Intronic
966943939 3:184764439-184764461 ATTTGCTTTTTGGGGGAAGAAGG + Intergenic
966943939 3:184764439-184764461 ATTTGCTTTTTGGGGGAAGAAGG + Intergenic
967142344 3:186571236-186571258 AAACGGCATTTGGGGGATGAGGG + Intronic
967142344 3:186571236-186571258 AAACGGCATTTGGGGGATGAGGG + Intronic
967237894 3:187405513-187405535 GAGTGTTATTTGGGGGATGCAGG - Intergenic
967237894 3:187405513-187405535 GAGTGTTATTTGGGGGATGCAGG - Intergenic
968425199 4:518661-518683 AAGTAGTGGCTGGGGGAAGATGG + Intronic
968425199 4:518661-518683 AAGTAGTGGCTGGGGGAAGATGG + Intronic
969037290 4:4264932-4264954 AAGCAGGATTTGGGAGAAGATGG - Intergenic
969037290 4:4264932-4264954 AAGCAGGATTTGGGAGAAGATGG - Intergenic
969876109 4:10136722-10136744 AATTGGTATATGGGTGAAGGTGG + Intergenic
969876109 4:10136722-10136744 AATTGGTATATGGGTGAAGGTGG + Intergenic
970705114 4:18792034-18792056 GAGTGCTTTTTGGGGGAAGTGGG - Intergenic
970705114 4:18792034-18792056 GAGTGCTTTTTGGGGGAAGTGGG - Intergenic
971971353 4:33624471-33624493 AACAGGCATTTGAGGGAAGATGG + Intergenic
971971353 4:33624471-33624493 AACAGGCATTTGAGGGAAGATGG + Intergenic
972287458 4:37662773-37662795 AGGTGGGAGGTGGGGGAAGATGG - Intronic
972287458 4:37662773-37662795 AGGTGGGAGGTGGGGGAAGATGG - Intronic
975390500 4:73811502-73811524 AAAAGGTATTTCTGGGAAGAGGG - Intergenic
975390500 4:73811502-73811524 AAAAGGTATTTCTGGGAAGAGGG - Intergenic
975868894 4:78756342-78756364 AGGAGGTATTGGGGGAAAGAGGG - Intergenic
975868894 4:78756342-78756364 AGGAGGTATTGGGGGAAAGAGGG - Intergenic
975891862 4:79039049-79039071 ATATGTTCTTTGGGGGAAGAAGG + Intergenic
975891862 4:79039049-79039071 ATATGTTCTTTGGGGGAAGAAGG + Intergenic
976087176 4:81418416-81418438 GAGTGGTAGTTGGGGAAGGAGGG - Intergenic
976087176 4:81418416-81418438 GAGTGGTAGTTGGGGAAGGAGGG - Intergenic
976495508 4:85725413-85725435 AAGAGGTCTTTGCGGGAACAGGG - Intronic
976495508 4:85725413-85725435 AAGAGGTCTTTGCGGGAACAGGG - Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
977380264 4:96263971-96263993 AAGTGGTTCTTGGGAGAAGAAGG + Intergenic
977380264 4:96263971-96263993 AAGTGGTTCTTGGGAGAAGAAGG + Intergenic
977801956 4:101245252-101245274 TAGTGCTCTTTGGGAGAAGATGG - Intronic
977801956 4:101245252-101245274 TAGTGCTCTTTGGGAGAAGATGG - Intronic
979580664 4:122355133-122355155 AACAGGGATTTGGGGGAAGGGGG + Intronic
979580664 4:122355133-122355155 AACAGGGATTTGGGGGAAGGGGG + Intronic
979929165 4:126608885-126608907 AAGGGGTTTTTGGAGGAATAAGG - Intergenic
979929165 4:126608885-126608907 AAGGGGTTTTTGGAGGAATAAGG - Intergenic
980328653 4:131381793-131381815 AAGTAGTTTCTGGGTGAAGAGGG - Intergenic
980328653 4:131381793-131381815 AAGTAGTTTCTGGGTGAAGAGGG - Intergenic
980799056 4:137724643-137724665 AAGTAGTATTTGGGTGAAACAGG - Intergenic
980799056 4:137724643-137724665 AAGTAGTATTTGGGTGAAACAGG - Intergenic
981876400 4:149551248-149551270 AGGTGGACTATGGGGGAAGAAGG - Intergenic
981876400 4:149551248-149551270 AGGTGGACTATGGGGGAAGAAGG - Intergenic
984411130 4:179399413-179399435 TAATGGTATTTGGAGGGAGATGG - Intergenic
984411130 4:179399413-179399435 TAATGGTATTTGGAGGGAGATGG - Intergenic
984812366 4:183806659-183806681 AAGTGGGGGTCGGGGGAAGAAGG - Intergenic
984812366 4:183806659-183806681 AAGTGGGGGTCGGGGGAAGAAGG - Intergenic
986291320 5:6401498-6401520 AAGGGTTTTTTGGGGGAAGAAGG - Intergenic
986291320 5:6401498-6401520 AAGGGTTTTTTGGGGGAAGAAGG - Intergenic
986308808 5:6536077-6536099 AGGTGGTGTTTGTGGGTAGAAGG - Intergenic
986308808 5:6536077-6536099 AGGTGGTGTTTGTGGGTAGAAGG - Intergenic
986645474 5:9912395-9912417 AAGTGGTGGTTGGGGAGAGAGGG - Intergenic
986645474 5:9912395-9912417 AAGTGGTGGTTGGGGAGAGAGGG - Intergenic
986969560 5:13316132-13316154 AAGTTTTGTTTGGGGGAAAAGGG - Intergenic
986969560 5:13316132-13316154 AAGTTTTGTTTGGGGGAAAAGGG - Intergenic
988920163 5:35934030-35934052 GAATGGCATTTGGGAGAAGATGG - Intronic
988920163 5:35934030-35934052 GAATGGCATTTGGGAGAAGATGG - Intronic
989191412 5:38673300-38673322 TGGAGATATTTGGGGGAAGAGGG + Intergenic
989191412 5:38673300-38673322 TGGAGATATTTGGGGGAAGAGGG + Intergenic
989814491 5:45719926-45719948 AAGTGGTAGTTGGTGGAGGGGGG - Intergenic
989814491 5:45719926-45719948 AAGTGGTAGTTGGTGGAGGGGGG - Intergenic
989838162 5:46022235-46022257 AAGTGATATTTGGGAGCACATGG + Intergenic
989838162 5:46022235-46022257 AAGTGATATTTGGGAGCACATGG + Intergenic
989984696 5:50684824-50684846 AAGTGGCATGTGGGGTATGAGGG + Intronic
989984696 5:50684824-50684846 AAGTGGCATGTGGGGTATGAGGG + Intronic
990014786 5:51046626-51046648 AACTTGTTTTTGAGGGAAGATGG - Intergenic
990014786 5:51046626-51046648 AACTTGTTTTTGAGGGAAGATGG - Intergenic
990727863 5:58776281-58776303 GAGTGGTATGTGGGGGTAGCGGG - Intronic
990727863 5:58776281-58776303 GAGTGGTATGTGGGGGTAGCGGG - Intronic
990938927 5:61180771-61180793 AAGTGATTATTGGGGGCAGAGGG + Intergenic
990938927 5:61180771-61180793 AAGTGATTATTGGGGGCAGAGGG + Intergenic
990956375 5:61344236-61344258 AAGTGGTATTTGGGGGAAGAAGG - Intronic
990956375 5:61344236-61344258 AAGTGGTATTTGGGGGAAGAAGG - Intronic
991539982 5:67716806-67716828 AACTGGGATTTGTGGGAACAAGG + Intergenic
991539982 5:67716806-67716828 AACTGGGATTTGTGGGAACAAGG + Intergenic
992220185 5:74564149-74564171 AAGTGGAATTTTTGGGTAGAAGG - Intergenic
992220185 5:74564149-74564171 AAGTGGAATTTTTGGGTAGAAGG - Intergenic
993180278 5:84543776-84543798 ATGTGATAAGTGGGGGAAGAAGG - Intergenic
993180278 5:84543776-84543798 ATGTGATAAGTGGGGGAAGAAGG - Intergenic
994728948 5:103469713-103469735 ATGTAGTATTTCGGGGAACAGGG - Intergenic
994728948 5:103469713-103469735 ATGTAGTATTTCGGGGAACAGGG - Intergenic
995718835 5:115108011-115108033 AATTGTCATTTGGGGGAAAAGGG + Intergenic
995718835 5:115108011-115108033 AATTGTCATTTGGGGGAAAAGGG + Intergenic
995865037 5:116681467-116681489 AAGGGGTTTCTGGGGTAAGATGG + Intergenic
995865037 5:116681467-116681489 AAGGGGTTTCTGGGGTAAGATGG + Intergenic
995904695 5:117109577-117109599 AATTGAAATTTGTGGGAAGATGG - Intergenic
995904695 5:117109577-117109599 AATTGAAATTTGTGGGAAGATGG - Intergenic
996578750 5:125006455-125006477 AAGGGGTATGTGGGGGGAGGGGG - Intergenic
996578750 5:125006455-125006477 AAGGGGTATGTGGGGGGAGGGGG - Intergenic
997610624 5:135213303-135213325 AAGGCATGTTTGGGGGAAGAAGG - Intronic
997610624 5:135213303-135213325 AAGGCATGTTTGGGGGAAGAAGG - Intronic
998170050 5:139867373-139867395 AAGTGGCATGGGTGGGAAGAGGG + Intronic
998170050 5:139867373-139867395 AAGTGGCATGGGTGGGAAGAGGG + Intronic
999558293 5:152769325-152769347 AGGAGATATTTGGAGGAAGATGG - Intergenic
999558293 5:152769325-152769347 AGGAGATATTTGGAGGAAGATGG - Intergenic
999674865 5:153988907-153988929 AAGTGGTTTTAGGTGGAAGCTGG - Intergenic
999674865 5:153988907-153988929 AAGTGGTTTTAGGTGGAAGCTGG - Intergenic
1001661275 5:173395383-173395405 AAGTGGACTTTGGGGGATGGGGG + Intergenic
1001661275 5:173395383-173395405 AAGTGGACTTTGGGGGATGGGGG + Intergenic
1002139262 5:177128869-177128891 ACCTGGTATTTGGGGCAGGAAGG + Intergenic
1002139262 5:177128869-177128891 ACCTGGTATTTGGGGCAGGAAGG + Intergenic
1002904943 6:1440627-1440649 AAATGGAATTTGGGGGCGGAGGG - Intergenic
1002904943 6:1440627-1440649 AAATGGAATTTGGGGGCGGAGGG - Intergenic
1003128681 6:3376914-3376936 AAATGGTAGATGGAGGAAGAAGG + Intronic
1003128681 6:3376914-3376936 AAATGGTAGATGGAGGAAGAAGG + Intronic
1003366220 6:5477377-5477399 AAGTGGTATTTCAGGAAAGCAGG - Intronic
1003366220 6:5477377-5477399 AAGTGGTATTTCAGGAAAGCAGG - Intronic
1004854555 6:19735878-19735900 AAGGGCTATTTGGGGGCAGTAGG - Intergenic
1004854555 6:19735878-19735900 AAGGGCTATTTGGGGGCAGTAGG - Intergenic
1005884843 6:30089505-30089527 AAGTGGCCTTTGGGTGATGAGGG + Intergenic
1005884843 6:30089505-30089527 AAGTGGCCTTTGGGTGATGAGGG + Intergenic
1006478601 6:34273795-34273817 AAGGGGTATTTGGAGGGAGGGGG + Intergenic
1006478601 6:34273795-34273817 AAGGGGTATTTGGAGGGAGGGGG + Intergenic
1007409224 6:41652165-41652187 AGGTGGCATTTGGGCAAAGAAGG + Intronic
1007409224 6:41652165-41652187 AGGTGGCATTTGGGCAAAGAAGG + Intronic
1007545931 6:42694630-42694652 AAGGGGACTTTTGGGGAAGATGG - Intergenic
1007545931 6:42694630-42694652 AAGGGGACTTTTGGGGAAGATGG - Intergenic
1007698033 6:43746316-43746338 CAGTGGTCTCTGGGGGAGGAGGG + Intergenic
1007698033 6:43746316-43746338 CAGTGGTCTCTGGGGGAGGAGGG + Intergenic
1007900137 6:45403763-45403785 ATGTGTGACTTGGGGGAAGAGGG + Intronic
1007900137 6:45403763-45403785 ATGTGTGACTTGGGGGAAGAGGG + Intronic
1007989083 6:46236293-46236315 AAGTGGTGGTTGGAGGAAAAAGG - Intronic
1007989083 6:46236293-46236315 AAGTGGTGGTTGGAGGAAAAAGG - Intronic
1008239468 6:49091524-49091546 AAGAGGTGTGTCGGGGAAGATGG - Intergenic
1008239468 6:49091524-49091546 AAGAGGTGTGTCGGGGAAGATGG - Intergenic
1008437226 6:51490528-51490550 AAGTGGGGCTTGGGGGAAGCTGG - Intergenic
1008437226 6:51490528-51490550 AAGTGGGGCTTGGGGGAAGCTGG - Intergenic
1009767782 6:68103934-68103956 AAGTGGTATTTGAGAAAACATGG + Intergenic
1009767782 6:68103934-68103956 AAGTGGTATTTGAGAAAACATGG + Intergenic
1012565972 6:100652394-100652416 AAGGTTTATTTGGGGAAAGACGG + Intronic
1012565972 6:100652394-100652416 AAGGTTTATTTGGGGAAAGACGG + Intronic
1014074160 6:117217426-117217448 GACTGGTAGGTGGGGGAAGAAGG - Intergenic
1014074160 6:117217426-117217448 GACTGGTAGGTGGGGGAAGAAGG - Intergenic
1014162599 6:118187206-118187228 CATTGGCATTTTGGGGAAGAAGG - Intronic
1014162599 6:118187206-118187228 CATTGGCATTTTGGGGAAGAAGG - Intronic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1015173751 6:130283299-130283321 AGGTGGTGTTTGAGAGAAGAGGG + Intronic
1015173751 6:130283299-130283321 AGGTGGTGTTTGAGAGAAGAGGG + Intronic
1015362583 6:132356901-132356923 AAGTAGAATTTGGAGAAAGAGGG + Intronic
1015362583 6:132356901-132356923 AAGTAGAATTTGGAGAAAGAGGG + Intronic
1016196054 6:141341826-141341848 AAGTGGTGGTAGGGGGACGAGGG + Intergenic
1016196054 6:141341826-141341848 AAGTGGTGGTAGGGGGACGAGGG + Intergenic
1017453323 6:154575007-154575029 GAGTGGTTGGTGGGGGAAGAAGG + Intergenic
1017453323 6:154575007-154575029 GAGTGGTTGGTGGGGGAAGAAGG + Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1018880758 6:167877510-167877532 AAGGGGTGATTGGGGGTAGAAGG + Intronic
1018880758 6:167877510-167877532 AAGGGGTGATTGGGGGTAGAAGG + Intronic
1019443372 7:1058652-1058674 GAGTGGCATTTGTGGGAAAAAGG - Exonic
1019443372 7:1058652-1058674 GAGTGGCATTTGTGGGAAAAAGG - Exonic
1020787359 7:12589096-12589118 AAGTGCTAAATGGAGGAAGAGGG + Intronic
1020787359 7:12589096-12589118 AAGTGCTAAATGGAGGAAGAGGG + Intronic
1021194182 7:17656360-17656382 GAAGGGTAGTTGGGGGAAGAGGG + Intergenic
1021194182 7:17656360-17656382 GAAGGGTAGTTGGGGGAAGAGGG + Intergenic
1021763242 7:23921717-23921739 AAGTGGGATTTAGAGGCAGAGGG + Intergenic
1021763242 7:23921717-23921739 AAGTGGGATTTAGAGGCAGAGGG + Intergenic
1021908744 7:25363101-25363123 ACATGGAATTTGGGGGAAAAAGG + Intergenic
1021908744 7:25363101-25363123 ACATGGAATTTGGGGGAAAAAGG + Intergenic
1022057303 7:26751784-26751806 AAATGCTTTTTGGGGGGAGAAGG - Intronic
1022057303 7:26751784-26751806 AAATGCTTTTTGGGGGGAGAAGG - Intronic
1022295851 7:29052127-29052149 CAGTGGACTTTGGGGGAAGATGG + Intronic
1022295851 7:29052127-29052149 CAGTGGACTTTGGGGGAAGATGG + Intronic
1022779704 7:33567795-33567817 AAGTAGGTTTTGGGGTAAGACGG - Intronic
1022779704 7:33567795-33567817 AAGTAGGTTTTGGGGTAAGACGG - Intronic
1023188784 7:37557329-37557351 GAGTGGTATTTTGGGGAAAGTGG + Intergenic
1023188784 7:37557329-37557351 GAGTGGTATTTTGGGGAAAGTGG + Intergenic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1026133358 7:67638043-67638065 AAGTGGCCTTTGGGGAGAGAAGG + Intergenic
1026133358 7:67638043-67638065 AAGTGGCCTTTGGGGAGAGAAGG + Intergenic
1028404381 7:90460315-90460337 AACTGGTATGTGGTGGAGGAGGG - Intronic
1028404381 7:90460315-90460337 AACTGGTATGTGGTGGAGGAGGG - Intronic
1028477297 7:91265727-91265749 AAGTGGTAGTTGAGGTAGGAGGG - Exonic
1028477297 7:91265727-91265749 AAGTGGTAGTTGAGGTAGGAGGG - Exonic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1032284141 7:130528180-130528202 CCGTGGGATGTGGGGGAAGAGGG + Intronic
1032284141 7:130528180-130528202 CCGTGGGATGTGGGGGAAGAGGG + Intronic
1032398064 7:131604954-131604976 AAGTGGCATCTGGTGGGAGAGGG + Intergenic
1032398064 7:131604954-131604976 AAGTGGCATCTGGTGGGAGAGGG + Intergenic
1034219044 7:149430485-149430507 AAAGGGGATTTGGAGGAAGAAGG - Intergenic
1034219044 7:149430485-149430507 AAAGGGGATTTGGAGGAAGAAGG - Intergenic
1037900763 8:22687324-22687346 AATGGGTATTTGGGGGTAGAAGG - Intergenic
1037900763 8:22687324-22687346 AATGGGTATTTGGGGGTAGAAGG - Intergenic
1038232115 8:25710982-25711004 AAGTGGAACTGGGGGGAAAAGGG - Intergenic
1038232115 8:25710982-25711004 AAGTGGAACTGGGGGGAAAAGGG - Intergenic
1038689197 8:29745972-29745994 AAGTGGAATTTGGGGGAGGCAGG + Intergenic
1038689197 8:29745972-29745994 AAGTGGAATTTGGGGGAGGCAGG + Intergenic
1039429658 8:37515900-37515922 AAGTGGCAGATGGGGGAAGTGGG + Intergenic
1039429658 8:37515900-37515922 AAGTGGCAGATGGGGGAAGTGGG + Intergenic
1039855263 8:41406650-41406672 AAGTGGGAATTTGGGAAAGAAGG - Intergenic
1039855263 8:41406650-41406672 AAGTGGGAATTTGGGAAAGAAGG - Intergenic
1041844148 8:62307912-62307934 AAGTAGTCTTGTGGGGAAGATGG + Intronic
1041844148 8:62307912-62307934 AAGTAGTCTTGTGGGGAAGATGG + Intronic
1041907847 8:63053238-63053260 AAGAGTAATTTGGGGGAAGATGG + Intronic
1041907847 8:63053238-63053260 AAGAGTAATTTGGGGGAAGATGG + Intronic
1042506834 8:69569828-69569850 AAAAGGTAGTTGGGAGAAGAAGG - Intronic
1042506834 8:69569828-69569850 AAAAGGTAGTTGGGAGAAGAAGG - Intronic
1043606768 8:82010064-82010086 AAGTGGGATTTGGGAGAAGGGGG + Intergenic
1043606768 8:82010064-82010086 AAGTGGGATTTGGGAGAAGGGGG + Intergenic
1046430539 8:114120812-114120834 TAGTACTATTTGGGGGTAGAGGG + Intergenic
1046430539 8:114120812-114120834 TAGTACTATTTGGGGGTAGAGGG + Intergenic
1046791929 8:118331818-118331840 AGGTGGTATTCGTGGGAAGCTGG + Intronic
1046791929 8:118331818-118331840 AGGTGGTATTCGTGGGAAGCTGG + Intronic
1047800416 8:128303567-128303589 AAATGCTATTTTGGGGCAGAAGG + Intergenic
1047800416 8:128303567-128303589 AAATGCTATTTTGGGGCAGAAGG + Intergenic
1048530269 8:135241769-135241791 AAGGGGTAAGTAGGGGAAGAGGG - Intergenic
1048530269 8:135241769-135241791 AAGGGGTAAGTAGGGGAAGAGGG - Intergenic
1048822633 8:138393958-138393980 AAGTGGGGTTTGGGGGCAGTTGG + Intronic
1048822633 8:138393958-138393980 AAGTGGGGTTTGGGGGCAGTTGG + Intronic
1049454679 8:142680919-142680941 AAGTGGTTTTTGGGGCACAAGGG + Intronic
1049454679 8:142680919-142680941 AAGTGGTTTTTGGGGCACAAGGG + Intronic
1053493485 9:38529884-38529906 AGGTGGGATTTGGGGGGAAAAGG - Intergenic
1053493485 9:38529884-38529906 AGGTGGGATTTGGGGGGAAAAGG - Intergenic
1053633945 9:39975599-39975621 GAGGGATATTTGGGGGAAGCTGG - Intergenic
1053633945 9:39975599-39975621 GAGGGATATTTGGGGGAAGCTGG - Intergenic
1053771800 9:41487905-41487927 GAGGGATATTTGGGGGAAGCTGG + Intergenic
1053771800 9:41487905-41487927 GAGGGATATTTGGGGGAAGCTGG + Intergenic
1054209942 9:62275098-62275120 GAGGGATATTTGGGGGAAGCTGG + Intergenic
1054209942 9:62275098-62275120 GAGGGATATTTGGGGGAAGCTGG + Intergenic
1054315051 9:63573856-63573878 GAGGGATATTTGGGGGAAGCTGG - Intergenic
1054315051 9:63573856-63573878 GAGGGATATTTGGGGGAAGCTGG - Intergenic
1054910431 9:70450344-70450366 TAGTGGGATTTGGGACAAGATGG + Intergenic
1054910431 9:70450344-70450366 TAGTGGGATTTGGGACAAGATGG + Intergenic
1055524740 9:77120367-77120389 CAGAAGTATCTGGGGGAAGACGG - Intergenic
1055524740 9:77120367-77120389 CAGAAGTATCTGGGGGAAGACGG - Intergenic
1055612990 9:78042200-78042222 ATGTGCTATTTGGAGGAAGCTGG + Intergenic
1055612990 9:78042200-78042222 ATGTGCTATTTGGAGGAAGCTGG + Intergenic
1055985862 9:82056251-82056273 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1055985862 9:82056251-82056273 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1057674224 9:97124698-97124720 AGGTGGGATTTGGGGGGAAAAGG - Intergenic
1057674224 9:97124698-97124720 AGGTGGGATTTGGGGGGAAAAGG - Intergenic
1057842041 9:98494294-98494316 AAGTGGGAGTTGGAGGAACAGGG + Intronic
1057842041 9:98494294-98494316 AAGTGGGAGTTGGAGGAACAGGG + Intronic
1058079664 9:100688687-100688709 AACTGGTATTTGGGGTGATAGGG + Intergenic
1058079664 9:100688687-100688709 AACTGGTATTTGGGGTGATAGGG + Intergenic
1058908404 9:109499119-109499141 CAGTGGAGTTTGGGGAAAGAGGG + Intergenic
1058908404 9:109499119-109499141 CAGTGGAGTTTGGGGAAAGAGGG + Intergenic
1060364378 9:122994786-122994808 AAGTGGTGTGTGGGAGAACAGGG + Intronic
1060364378 9:122994786-122994808 AAGTGGTGTGTGGGAGAACAGGG + Intronic
1060433553 9:123572116-123572138 AAGGGAAATTTGGGGGATGATGG - Intronic
1060433553 9:123572116-123572138 AAGGGAAATTTGGGGGATGATGG - Intronic
1060743275 9:126113448-126113470 ATGTGGGAGTTGGGGGACGATGG + Intergenic
1060743275 9:126113448-126113470 ATGTGGGAGTTGGGGGACGATGG + Intergenic
1060955733 9:127637960-127637982 AAATTGTATTTGTGGGAAGTGGG - Intronic
1060955733 9:127637960-127637982 AAATTGTATTTGTGGGAAGTGGG - Intronic
1062259442 9:135653299-135653321 AAGAGGTATTTTTGGTAAGAAGG + Intergenic
1062259442 9:135653299-135653321 AAGAGGTATTTTTGGTAAGAAGG + Intergenic
1062561042 9:137142037-137142059 AAGTGGTCGTTGGGGGTAGGTGG - Exonic
1062561042 9:137142037-137142059 AAGTGGTCGTTGGGGGTAGGTGG - Exonic
1062640440 9:137515789-137515811 AGGGGGGATTTGGGGGAAGGGGG - Intronic
1062640440 9:137515789-137515811 AGGGGGGATTTGGGGGAAGGGGG - Intronic
1185796556 X:2970343-2970365 AAGTGGTTGTTTGGGAAAGATGG - Intergenic
1185796556 X:2970343-2970365 AAGTGGTTGTTTGGGAAAGATGG - Intergenic
1186191877 X:7074665-7074687 AAATGGTGTTTCTGGGAAGAAGG + Intronic
1186191877 X:7074665-7074687 AAATGGTGTTTCTGGGAAGAAGG + Intronic
1186267280 X:7844576-7844598 AAGTGGTATGTGGGGAGGGAGGG + Intergenic
1186267280 X:7844576-7844598 AAGTGGTATGTGGGGAGGGAGGG + Intergenic
1186925866 X:14332824-14332846 AAATGACATTTGGGGGAAAAAGG - Intergenic
1186925866 X:14332824-14332846 AAATGACATTTGGGGGAAAAAGG - Intergenic
1187699371 X:21950272-21950294 ATGTGGAATTTTGAGGAAGATGG + Intronic
1187699371 X:21950272-21950294 ATGTGGAATTTTGAGGAAGATGG + Intronic
1187923250 X:24226650-24226672 AAGGGAGATTTGGGGGATGATGG - Intergenic
1187923250 X:24226650-24226672 AAGGGAGATTTGGGGGATGATGG - Intergenic
1189086855 X:38034569-38034591 AAGTGGTTTCTGGGGTATGATGG - Intronic
1189086855 X:38034569-38034591 AAGTGGTTTCTGGGGTATGATGG - Intronic
1189988184 X:46572191-46572213 AAGAGGTGGGTGGGGGAAGAGGG + Intergenic
1189988184 X:46572191-46572213 AAGAGGTGGGTGGGGGAAGAGGG + Intergenic
1191175844 X:57501174-57501196 GAATGGTATATGGGGGCAGAGGG - Intergenic
1191175844 X:57501174-57501196 GAATGGTATATGGGGGCAGAGGG - Intergenic
1196071452 X:111527671-111527693 AAATAGTAGTTGGGGGATGAGGG + Intergenic
1196071452 X:111527671-111527693 AAATAGTAGTTGGGGGATGAGGG + Intergenic
1197325512 X:125088988-125089010 AAGTGGTCTTTGGGGTAATTTGG - Intergenic
1197325512 X:125088988-125089010 AAGTGGTCTTTGGGGTAATTTGG - Intergenic
1200147136 X:153932200-153932222 AAGTGGGATTGGGGGGAAGGAGG - Intronic
1200147136 X:153932200-153932222 AAGTGGGATTGGGGGGAAGGAGG - Intronic
1202176193 Y:22101062-22101084 AAGTGGTTTTTGTTGGGAGAAGG + Intergenic
1202176193 Y:22101062-22101084 AAGTGGTTTTTGTTGGGAGAAGG + Intergenic
1202215168 Y:22485322-22485344 AAGTGGTTTTTGTTGGGAGAAGG - Intergenic
1202215168 Y:22485322-22485344 AAGTGGTTTTTGTTGGGAGAAGG - Intergenic