ID: 990957879

View in Genome Browser
Species Human (GRCh38)
Location 5:61361967-61361989
Sequence ATGTTTTCACATATGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 583}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990957874_990957879 11 Left 990957874 5:61361933-61361955 CCTAAAATGATTAACCATTATGT 0: 1
1: 0
2: 0
3: 19
4: 302
Right 990957879 5:61361967-61361989 ATGTTTTCACATATGGAAATAGG 0: 1
1: 0
2: 3
3: 46
4: 583
990957875_990957879 -3 Left 990957875 5:61361947-61361969 CCATTATGTGAGTCTCCCACATG 0: 1
1: 0
2: 0
3: 9
4: 146
Right 990957879 5:61361967-61361989 ATGTTTTCACATATGGAAATAGG 0: 1
1: 0
2: 3
3: 46
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990957879 Original CRISPR ATGTTTTCACATATGGAAAT AGG Intronic
901729564 1:11269475-11269497 AGTTTTACACATAAGGAAATAGG - Intergenic
902450511 1:16493972-16493994 CAGTTTTCTCATCTGGAAATGGG - Intergenic
902502347 1:16919370-16919392 CAGTTTTCTCATCTGGAAATAGG + Intronic
902696214 1:18142714-18142736 TTGTTTGCATATATGCAAATTGG + Intronic
903590936 1:24455466-24455488 ATGTTTGCACATATGCACAGGGG + Intronic
904474855 1:30758104-30758126 CTGTTTCCTCATCTGGAAATGGG - Intergenic
904947245 1:34208398-34208420 GTGTTGTCACATACGGACATCGG - Intronic
904987599 1:34564732-34564754 CTGTCTTCACATTTGAAAATTGG - Intergenic
906620410 1:47272933-47272955 ATGTTTGCCCATGTTGAAATTGG + Intronic
907323936 1:53624046-53624068 ATATTTTCACATATGTATTTTGG - Intronic
907566730 1:55442470-55442492 CTGTTTTCACTGAAGGAAATAGG - Intergenic
907693308 1:56693423-56693445 ATTCTTTCAACTATGGAAATAGG + Intronic
907799833 1:57753513-57753535 CTGTTTTCTCATATGTAAAATGG + Intronic
907948924 1:59162048-59162070 AGGTTTTAACATATGGATTTTGG + Intergenic
908371998 1:63492087-63492109 ATGTTTAGACATATGGCAATTGG - Intronic
908498955 1:64723663-64723685 ATGTTTTAGTATATGAAAATGGG + Intergenic
909021603 1:70437489-70437511 ATTATTTCAGATAAGGAAATAGG + Intronic
909196278 1:72629106-72629128 CTGTTTTCTCATTTGTAAATGGG - Intergenic
909425773 1:75523086-75523108 ATGTTTTATCATTTGTAAATGGG - Intronic
909663930 1:78113069-78113091 ATGTTTTAAAACATAGAAATGGG - Intronic
909994932 1:82267672-82267694 ATGTTTTATCATATGTAATTGGG - Intergenic
910595951 1:88980938-88980960 ATGTTTTAACATTTGCAACTAGG - Exonic
910684793 1:89905222-89905244 ATGTCTTAGCACATGGAAATAGG - Intronic
911425709 1:97708353-97708375 ACTTTTTTACATATGGAAGTAGG + Intronic
911948517 1:104141007-104141029 ATGTGTTCACAGCTGCAAATTGG + Intergenic
912691347 1:111806497-111806519 TTGTTTTCTCATCTGTAAATGGG + Intronic
913046985 1:115082409-115082431 CTGTTTTCTCATATGTAAACTGG + Intronic
913083645 1:115413689-115413711 CTATTTCCACATAAGGAAATTGG - Intergenic
913973256 1:143432880-143432902 AAGTTTCCACATATGAAATTTGG - Intergenic
914067642 1:144258487-144258509 AAGTTTCCACATATGAAATTTGG - Intergenic
914111513 1:144707867-144707889 AAGTTTCCACATATGAAATTTGG + Intergenic
915278266 1:154804710-154804732 ATGCTTTCATATATGTAAAAGGG - Intronic
916628107 1:166581798-166581820 AAGTTTTCATTTATAGAAATGGG - Intergenic
916700067 1:167282916-167282938 CTGTTTTCTCATATGTAAAATGG + Intronic
917197481 1:172481736-172481758 ATGCTGTCATCTATGGAAATGGG + Intergenic
917640314 1:176977329-176977351 ATGTTTTTTTATATGGAAACTGG - Intronic
918747456 1:188223161-188223183 TTGTTATCACATAGGGAAGTAGG - Intergenic
918939016 1:190965770-190965792 TTGTTATCACCTATGGAATTAGG - Intergenic
919090448 1:192972631-192972653 ATATTTTTACATAGGGATATAGG + Intergenic
919178883 1:194056696-194056718 ATGTGTTCTCATTTGGAAATAGG - Intergenic
919226329 1:194708928-194708950 ATGGTTGAACATATTGAAATTGG + Intergenic
919367186 1:196676762-196676784 ATTTTTTCATCTATGAAAATTGG + Intronic
919409154 1:197222292-197222314 TTATTTTCAGAAATGGAAATTGG + Intergenic
920569591 1:207006534-207006556 ATGTCTTCATATTTGGATATTGG - Intergenic
921538990 1:216389172-216389194 ATTGTTACACATATGGGAATTGG - Intronic
921578794 1:216871691-216871713 ATGTTTCCACATATTGATAAAGG - Intronic
921750168 1:218783037-218783059 GTGTTTACACAGGTGGAAATAGG + Intergenic
922216533 1:223524570-223524592 AAGTTTTCTCATATGAAGATGGG - Intergenic
924386694 1:243505843-243505865 AAGTTTTATCATAGGGAAATTGG - Intronic
1062784672 10:253265-253287 ATAATTTCACATATGGATAAAGG - Exonic
1064268631 10:13846018-13846040 ATTTTTTCAGATGAGGAAATTGG - Intronic
1064571696 10:16700064-16700086 TCATTTTCACTTATGGAAATTGG + Intronic
1065238045 10:23674583-23674605 ATGTTTTACCATGTGGAAAATGG - Intergenic
1065330888 10:24597786-24597808 ATTTTTTCCCATATAGTAATGGG - Intronic
1066493280 10:35915744-35915766 ATTTTTCAAAATATGGAAATGGG - Intergenic
1067042694 10:42963388-42963410 ATGTTATCACTGAAGGAAATTGG - Intergenic
1067332751 10:45337230-45337252 ATGTTTCCACATATGGTCAAAGG - Intergenic
1067915163 10:50389673-50389695 ACCTTTTCATAAATGGAAATTGG - Intronic
1067927465 10:50524659-50524681 ATGTTTGCTCATCTGTAAATGGG - Intronic
1069220212 10:65873867-65873889 ATCTTTTCAAAAATTGAAATTGG - Intergenic
1069576967 10:69537678-69537700 ATGTGTTCTTATTTGGAAATAGG - Intergenic
1069932706 10:71893386-71893408 ATGTTTTAAAATATGCAAAAAGG - Intergenic
1071380255 10:85052396-85052418 ATGTTTTTACAAAGGGAGATTGG + Intergenic
1073314566 10:102569983-102570005 AGGTCTTCCCATATGGAAAAGGG + Intronic
1073505453 10:103984268-103984290 ATGTTTTTACCTATATAAATTGG - Intronic
1074211392 10:111338525-111338547 CATTTTACACATATGGAAATTGG - Intergenic
1074249185 10:111726868-111726890 CTGTTTTCTCATATGTAAAATGG - Intergenic
1074463720 10:113663737-113663759 ACCTTCTCACATATGGACATAGG - Intronic
1074863501 10:117531449-117531471 CCGTTTTCTCATATGGAAAATGG + Intergenic
1074959693 10:118431162-118431184 ATTTTTTTCCATATGGAGATTGG + Intergenic
1075771643 10:124942960-124942982 CTGTTTGCACATATGAAAACTGG + Exonic
1075840368 10:125496934-125496956 ATGTTTTCTCATCTGTAAAATGG - Intergenic
1075841394 10:125507602-125507624 AAGTCTGCACATGTGGAAATAGG - Intergenic
1076115655 10:127896397-127896419 AGGTTTTTACATATGTAAATTGG + Intergenic
1078001540 11:7500574-7500596 ATGTTTCCTCATTTGGAAAATGG + Intronic
1078715105 11:13832410-13832432 ATGTCTTCACATGTGGGAAAGGG - Intergenic
1078719912 11:13875026-13875048 ATGTTTTTACTCATGGGAATGGG + Intergenic
1078826034 11:14931094-14931116 CTGTTTTCTCATTTGTAAATGGG + Intronic
1078893140 11:15575567-15575589 ATGTTTTCTCATATGTAAAGTGG - Intergenic
1078956616 11:16204160-16204182 ATGTTTCATCATATGTAAATTGG - Intronic
1079044752 11:17091417-17091439 ATGTTTTGACATATGGATTTGGG + Exonic
1080268773 11:30428102-30428124 TTATTGCCACATATGGAAATGGG - Intronic
1080286013 11:30613716-30613738 ATTTTTTGACATATAAAAATCGG + Intergenic
1080330091 11:31126668-31126690 ATGATTTCTTAAATGGAAATAGG + Intronic
1080534032 11:33204372-33204394 GAGTTTTCTCATATGTAAATTGG + Intergenic
1080698858 11:34626894-34626916 AAGTTTTCTCATCTGGAAAATGG + Intronic
1080984801 11:37449448-37449470 ATATTTTCTTATTTGGAAATAGG - Intergenic
1081491608 11:43573795-43573817 ATGTTTTTAGATATGAAATTAGG - Intronic
1081736480 11:45408089-45408111 ATGTGGTCCCATATGGAAACAGG - Intergenic
1082697377 11:56386363-56386385 ATGTTTACACATTTGGAAGTGGG + Intergenic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085593082 11:77782632-77782654 ATGTTTCTACATTTGAAAATAGG + Intronic
1085851649 11:80127324-80127346 ATGTTTTCTCATCTGCAAAATGG + Intergenic
1086017661 11:82186413-82186435 CAGTTTTCTCATATGGCAATAGG - Intergenic
1086993187 11:93328731-93328753 ATGTTTTCACATAGAAGAATAGG - Intergenic
1087926571 11:103925525-103925547 CAGTTTTCACATATTTAAATAGG - Intronic
1087952122 11:104235310-104235332 ATGTTTAGACATATGAAAGTTGG - Intergenic
1088939672 11:114440091-114440113 ATGTTCTCACTTATGGAATGAGG - Intronic
1089651689 11:119918607-119918629 ATGTTTTCACACATGATAACTGG - Intergenic
1090106716 11:123861240-123861262 ATGTCATCACATGTGGACATTGG - Intergenic
1090506876 11:127324611-127324633 TTGTTTTCACATATTCAAATTGG - Intergenic
1090936836 11:131350730-131350752 ATGCTTTCAGCTATGGAGATGGG - Intergenic
1091128713 11:133125229-133125251 ATGTTTTCACTTAGGGAAAATGG - Intronic
1092761500 12:11815221-11815243 TTGTTTTCTCATCTGGAAAGTGG - Intronic
1093380763 12:18489957-18489979 ATCTCTTCACATAGGAAAATAGG + Intronic
1095478772 12:42612039-42612061 AAAGTTTCACATATGGGAATGGG + Intergenic
1096339519 12:50785914-50785936 ATGTTTTATCACAAGGAAATGGG - Intronic
1097476289 12:60059517-60059539 ATTTTCTCACAAAGGGAAATGGG + Intergenic
1097576795 12:61403988-61404010 ATGACTTTATATATGGAAATGGG - Intergenic
1097792471 12:63829483-63829505 ATGTTTTCTTATATGGCAAAGGG - Intergenic
1097808868 12:63996067-63996089 CTTTTTTCACATATAGAGATTGG - Intronic
1097994675 12:65875166-65875188 ATATTTTCTCATATGAGAATAGG - Intronic
1098017277 12:66119157-66119179 CTGTTTTCTCATCTGAAAATAGG + Exonic
1098827970 12:75322808-75322830 ATTTTGTCGCACATGGAAATTGG - Intronic
1098937157 12:76493138-76493160 TTGTTTTCTCATTTGCAAATAGG + Intronic
1099420409 12:82451421-82451443 AAGTTTTCCCATCTGTAAATTGG + Intronic
1100422767 12:94453713-94453735 ATGTTTTCAAATGAGAAAATAGG + Intronic
1100482468 12:94992535-94992557 ATGTTTTCTCATGTAGAACTTGG + Intronic
1100735475 12:97524868-97524890 ATCTTTTCAAATATGCAAATTGG - Intergenic
1100860098 12:98795860-98795882 TTGTTTTCCCATATGTAAAGTGG + Intronic
1100869026 12:98891229-98891251 TGGTTTTCTCATATGGAAATAGG - Intronic
1101176671 12:102158817-102158839 TTCTTTTCACATATACAAATTGG - Intronic
1102423003 12:112818737-112818759 ATGTTTTCCCAAAAGAAAATTGG + Intronic
1102747436 12:115261577-115261599 ATTTTTTCATACATGGAAGTGGG + Intergenic
1102933167 12:116877759-116877781 AAGTTTTCCCATATGTAAAATGG - Intronic
1103250933 12:119499468-119499490 TTGTTTTCTCATCTGAAAATGGG + Intronic
1103536704 12:121638476-121638498 CTGTTTTCACATCTGTAAAATGG - Intronic
1104126259 12:125849058-125849080 ATTTGTTCACAAATGGAAAGGGG - Intergenic
1105730101 13:23204954-23204976 ATGTTTTTACATATGCAAAGAGG + Intronic
1105947121 13:25199622-25199644 AGGTTTTCTCATTTGTAAATGGG - Intergenic
1106773984 13:32990896-32990918 ATGTGATCATATTTGGAAATAGG - Intergenic
1108617822 13:52151690-52151712 ATGTGTTCTCAGATGGAAAACGG - Intronic
1108932065 13:55837502-55837524 CTGTTTCCTCATCTGGAAATGGG + Intergenic
1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG + Intronic
1110356855 13:74576503-74576525 AGATGTTCCCATATGGAAATAGG - Intergenic
1110645785 13:77881957-77881979 ATGCTTTCCCATAGGGAAATTGG + Intergenic
1111265424 13:85805972-85805994 ATGTTTCCATATACTGAAATGGG + Intergenic
1111371553 13:87325660-87325682 ATGTTTTTACATAAGGAGAGAGG + Intergenic
1111423058 13:88042867-88042889 ATGTTTTCAGAGCTGGAGATTGG + Intergenic
1111677279 13:91402580-91402602 CTGTTTTCTCATTTAGAAATAGG + Intronic
1111707764 13:91772354-91772376 ATGTGATGACATTTGGAAATTGG + Intronic
1111897933 13:94164358-94164380 GAGTTTTCTCATTTGGAAATTGG - Intronic
1112195101 13:97218023-97218045 ATGCTTTCACTTATTGAAATGGG + Intergenic
1112220372 13:97483278-97483300 ATGTGATTACATTTGGAAATAGG + Intergenic
1112979838 13:105369649-105369671 TTGTTCTCACAGATGTAAATGGG - Intergenic
1112987833 13:105473328-105473350 ATGTGTTCACATAATTAAATGGG + Intronic
1113596266 13:111536139-111536161 AAGTGTTGAAATATGGAAATTGG - Intergenic
1114171490 14:20277287-20277309 AAGTTTTAACATATGAAATTCGG + Intronic
1114929396 14:27448926-27448948 ATGTTTTCACTTTTAGAAACAGG - Intergenic
1115282838 14:31684177-31684199 TTGTTTTCTCATCTGTAAATGGG + Intronic
1115658085 14:35463181-35463203 GAGTTTTCACATATACAAATAGG + Intergenic
1115802436 14:37010357-37010379 ATCATTTCACCTATGGCAATAGG - Intronic
1115916849 14:38324743-38324765 ATGTTTTTATATATAGAAGTAGG + Intergenic
1116176038 14:41471640-41471662 ATGTTATCATATTTGGAAATTGG - Intergenic
1116340081 14:43712051-43712073 ATTTTTTCAGATGAGGAAATGGG - Intergenic
1116419530 14:44716668-44716690 ATGTTTTAACATCTCTAAATTGG + Intergenic
1116459126 14:45151314-45151336 ATTTTCTCACATATTAAAATAGG - Intronic
1116860092 14:49988223-49988245 CTGTTGTCACATTTGGAAAATGG - Intronic
1116927718 14:50657423-50657445 CTGTTTTCTCATCTGTAAATTGG - Intronic
1117392969 14:55280204-55280226 ATGTTTTAAAAAATGGGAATGGG + Intronic
1117846023 14:59912761-59912783 ATGTTACCATATTTGGAAATAGG - Intergenic
1117852422 14:59989280-59989302 AAGATTTCACATATGGATAATGG - Intronic
1118244083 14:64091463-64091485 ATTTTTACAGATAAGGAAATTGG + Intronic
1119148445 14:72337000-72337022 ATGTGATCTCATTTGGAAATAGG - Intronic
1119406108 14:74400804-74400826 GTGTTTTCTCATCTGGAAAACGG - Intergenic
1119660622 14:76448779-76448801 AAGTTTACACATATGCAAACTGG - Intronic
1119729385 14:76941492-76941514 AAGTTTTCATATCTGGAAAATGG - Intergenic
1119821657 14:77621457-77621479 ATGATTTCCCAAAGGGAAATGGG + Intergenic
1119908329 14:78325759-78325781 ATGTTTGTACAAATGGAAACAGG - Intronic
1120848346 14:89146462-89146484 GTGATTTCTCATGTGGAAATGGG + Intronic
1121514747 14:94542183-94542205 CAGTTTTCACATCTGGAAAATGG - Intergenic
1121585659 14:95061378-95061400 ATGTGGCCACATTTGGAAATAGG - Intergenic
1121679920 14:95785083-95785105 AAGTTTTCACATTCGGAAACAGG - Intergenic
1122170241 14:99867239-99867261 ATGTTTTAAAATCAGGAAATGGG + Intronic
1123626693 15:22232034-22232056 ATGTTGCCTCATTTGGAAATAGG + Intergenic
1124206447 15:27724830-27724852 CAGTTTTCTCATATGTAAATTGG - Intergenic
1124642788 15:31407001-31407023 ATGTTATCTCACATGGAAAAAGG - Intronic
1124835926 15:33195810-33195832 CTGTTTTCAAATAAGTAAATGGG + Intergenic
1125090465 15:35785072-35785094 ATGTTTTCTGATGTGGAAATGGG + Intergenic
1125549574 15:40535480-40535502 GTTTTTCCACATATTGAAATTGG + Intronic
1125587441 15:40830826-40830848 CTGTTTTCACATCTGCAGATTGG + Intergenic
1126245963 15:46506033-46506055 ATGTTTTCATATATGACAAAAGG - Intergenic
1126489649 15:49222810-49222832 ATTTTTACATATATGTAAATAGG + Intronic
1127059541 15:55168237-55168259 CAGTTTTCACATCTGTAAATTGG - Intergenic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1127305916 15:57705770-57705792 AGTTTTACACATTTGGAAATAGG + Intronic
1127733781 15:61823134-61823156 ATGTTTTCACATATGAATTTTGG - Intergenic
1128145019 15:65328229-65328251 TTTCTTTCACATCTGGAAATGGG + Exonic
1128954260 15:71923179-71923201 ATGGTTTAACATATGCAAATCGG - Intronic
1129110232 15:73332877-73332899 ATGTTTTCTCATCTGGAAAATGG + Intronic
1130131373 15:81145645-81145667 ATGGTTACACATCTGTAAATGGG + Intronic
1130191653 15:81742181-81742203 ATGTTCTCATATACTGAAATTGG - Intergenic
1130630996 15:85569081-85569103 GTGGTTTCATAAATGGAAATAGG + Intronic
1132239086 15:100243917-100243939 CTGTTTTCTCATCTGGAAAATGG - Intronic
1133078350 16:3296974-3296996 ATATTTTCAAACATGGAAAGTGG + Intronic
1133958087 16:10464715-10464737 ATGTTTACAGAGATGGAAAGGGG + Intronic
1134286397 16:12865701-12865723 CTGTTTTAAGATATTGAAATGGG - Intergenic
1134399007 16:13891433-13891455 ATGGTTTCACATGTGGAACGTGG + Intergenic
1135096292 16:19567476-19567498 ATGTTTTCTCAAATAAAAATTGG + Intronic
1135338365 16:21624396-21624418 ATGTGTTGAGATTTGGAAATAGG + Intronic
1135774058 16:25240726-25240748 ATTTTTTCAGATTTTGAAATCGG - Exonic
1137245033 16:46695740-46695762 ATATTTTCAAATATGTAAACTGG + Intronic
1137463182 16:48684493-48684515 ATGTTTTCACAAATACAAAATGG + Intergenic
1137505156 16:49048298-49048320 ATGTGATCTCATTTGGAAATAGG + Intergenic
1137958259 16:52854570-52854592 ATGTTCTCACTTATGTAAGTGGG - Intergenic
1138794058 16:59946185-59946207 ATGGTTTCATATACAGAAATAGG - Intergenic
1138858530 16:60725745-60725767 AAGTGTTCTCATATGTAAATGGG + Intergenic
1139120072 16:64005305-64005327 AAGTTTTGAAATAGGGAAATAGG - Intergenic
1139162559 16:64528652-64528674 ATATTTTGACATATGGTAATAGG + Intergenic
1139288993 16:65840306-65840328 ATGTTTTCACTTATAGAAACAGG - Intergenic
1139659867 16:68413308-68413330 ATGCTTTCCCATGTGGAAAGGGG - Intronic
1141007403 16:80365161-80365183 CTGTTTCCACATCTGGAAAATGG - Intergenic
1141977294 16:87525387-87525409 ATGTTGCCTCATTTGGAAATAGG - Intergenic
1144095064 17:11892899-11892921 ATTTTTTCCAATATGTAAATTGG + Intronic
1144331517 17:14228363-14228385 ATGTTTTAACATCCGAAAATTGG - Intergenic
1147220657 17:38927677-38927699 TTGTTTTAAAACATGGAAATTGG - Intergenic
1149028750 17:52060901-52060923 TTGTTTTCTCATCTGGAAAAAGG + Intronic
1149187636 17:54017987-54018009 GTGTTTTCAAATATGTTAATTGG + Intergenic
1149301226 17:55305964-55305986 TTATTTCCACATATGGAAAATGG + Intronic
1149718223 17:58815869-58815891 ATATTTTCAAATATGAAAATAGG - Intronic
1149956047 17:61051390-61051412 ATTTTATCACATGTGTAAATTGG - Intronic
1150847236 17:68671684-68671706 ATGTTGTCACATATGTCAATAGG - Intergenic
1150921257 17:69486006-69486028 AAGTTTACATAAATGGAAATAGG - Intronic
1155880092 18:31135530-31135552 ATGTTTTCAAGTATAAAAATAGG - Intronic
1155994777 18:32319217-32319239 ATCTCTTCACATTTGGATATGGG - Intronic
1156007506 18:32461081-32461103 ATATTTTTAAATATGTAAATTGG - Intronic
1156419405 18:36934244-36934266 ATGTTTTCCTCTCTGGAAATTGG + Intronic
1156440527 18:37182753-37182775 ATATTTTCACATAAGGAATTGGG - Intronic
1156701708 18:39834058-39834080 ATGTTTTCAAATATAGAAGATGG - Intergenic
1156816381 18:41316621-41316643 GAGTTTTAAAATATGGAAATTGG + Intergenic
1157497740 18:48168289-48168311 AAGTTTTCAGATCTGGAAACTGG + Intronic
1158092435 18:53729570-53729592 CTGTTTTCAGATTTGGAAGTAGG + Intergenic
1158530189 18:58253772-58253794 ATTATTTCAGATACGGAAATGGG - Intronic
1159038857 18:63303812-63303834 ATGTTGTCATAAATGGAAATGGG + Intronic
1159624787 18:70680039-70680061 ATGTTTTTACATCAGCAAATAGG + Intergenic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1161874029 19:6893704-6893726 TTATTTTCACATATGGGTATTGG + Intronic
1162116713 19:8434393-8434415 ATATTTTAAAATATGTAAATAGG + Intronic
1162607864 19:11725110-11725132 ATGATTTGAAATATGGAAAGAGG - Intronic
1163111773 19:15165677-15165699 ATTTTTTCTCATTTGGAAAATGG - Intronic
1163760763 19:19135195-19135217 CAGTTTTCTCATCTGGAAATGGG + Intronic
1164154612 19:22584292-22584314 ATGTTTTCATTTATTGTAATAGG + Intergenic
1164525829 19:29012859-29012881 ATGTGAACACATTTGGAAATAGG - Intergenic
1164577031 19:29411497-29411519 ATGCTTTCGGATTTGGAAATGGG + Intergenic
1164807197 19:31126210-31126232 ATGCTTTCACTTCTGGAATTTGG - Intergenic
1165529286 19:36383913-36383935 ATATTTTCACATCTGAATATTGG - Intronic
1166385908 19:42380867-42380889 TTGTTTTCTCATCTGCAAATGGG - Intergenic
1167783299 19:51614945-51614967 TTGTTTTCTCCTATAGAAATTGG - Intronic
924968833 2:104568-104590 ATGTTTCAAAATATGCAAATTGG - Intergenic
925742011 2:7014002-7014024 CAGTTTTCACATATGAAAAATGG + Intronic
925986714 2:9222327-9222349 ATGTTTTTGCATTTGTAAATGGG + Intronic
926031219 2:9591227-9591249 ATGTTCTCAAAAATGAAAATTGG - Intronic
927052301 2:19342408-19342430 AAATTTTCAAATATGGAAAAAGG + Intergenic
927178064 2:20424283-20424305 CAGTTTTCACTTCTGGAAATGGG - Intergenic
927565460 2:24108599-24108621 TTGGTTTAACATATGCAAATTGG + Intronic
928045174 2:27924101-27924123 ATGATTCCACTTATGGAAAAAGG - Intronic
929103972 2:38345838-38345860 CTGTTTTCTCATCTGGAAAATGG + Intronic
929209581 2:39340405-39340427 ATGTTCTCATATATGAATATTGG - Intronic
929417415 2:41757403-41757425 ATGGTTTCACATAGGGGTATGGG + Intergenic
930459301 2:51650953-51650975 CAGTTTTCTCATATGTAAATAGG - Intergenic
930608811 2:53518921-53518943 CAGTTTTCCCATATGCAAATGGG - Intergenic
930862443 2:56089014-56089036 AGGTTTTAACATGTTGAAATTGG - Intergenic
931013378 2:57944983-57945005 CTGTTTCCTCATATGTAAATTGG - Intronic
931940395 2:67245781-67245803 ATGTTCTCTCATATGGAAAAAGG + Intergenic
932039219 2:68281411-68281433 CTGTTTTCACATTTGTAAAATGG + Intergenic
932461290 2:71883536-71883558 CTGTTTTCACCTTTGGAAACTGG - Intergenic
932783566 2:74579560-74579582 CAGTTTTCTCATATGGAAAATGG + Intronic
933101676 2:78267652-78267674 ATGTGATCATATATGGAAACAGG + Intergenic
933195987 2:79390672-79390694 TGGTTTTCACATATGGAAATAGG + Intronic
933438497 2:82279534-82279556 ATGTTTACAGATGAGGAAATGGG - Intergenic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
933553473 2:83804432-83804454 ATATTTAGACATATGGAATTAGG + Intergenic
933889129 2:86749845-86749867 CTGTTTTCACATCTAGAGATAGG + Intronic
934177951 2:89593837-89593859 AAGTTTCCACATATGAAATTTGG - Intergenic
934288249 2:91668138-91668160 AAGTTTCCACATATGAAATTTGG - Intergenic
935127364 2:100236153-100236175 ATGTGACCACATTTGGAAATAGG + Intergenic
935366781 2:102301537-102301559 TTTTTTTCACATATGGAATTTGG + Intergenic
935486726 2:103665215-103665237 ATGTTTTCACACATGGTTCTGGG - Intergenic
936000788 2:108827907-108827929 ATATGTTTACATATGGGAATGGG - Intronic
936346706 2:111680933-111680955 ATGTGTCCTCATTTGGAAATAGG + Intergenic
936364488 2:111840255-111840277 TTGTTTTCACATATGTAATGTGG - Intronic
936450925 2:112633579-112633601 ATGTTATCACATTGGGAATTAGG - Intergenic
936787440 2:116110949-116110971 ATATGTTCTTATATGGAAATAGG - Intergenic
936798704 2:116240016-116240038 ATTTTTACACATATGTTAATGGG - Intergenic
937077750 2:119119236-119119258 CAGTTTTCTCATCTGGAAATGGG - Intergenic
937176982 2:119947992-119948014 CTTTTTTCAAATAAGGAAATAGG - Intronic
938997985 2:136701008-136701030 ATGTTTTCCCATTTGGATTTTGG - Intergenic
939355931 2:141101865-141101887 ATGCTTTCACATAGTGAAAATGG + Intronic
939431719 2:142118032-142118054 ATGGTTTCACAGAGAGAAATAGG - Intronic
939492721 2:142896040-142896062 ATGTTTTTACATTTATAAATGGG - Intronic
939611560 2:144316926-144316948 TTGTTTCCTCATAAGGAAATTGG + Intronic
941957573 2:171220158-171220180 ATGTTATCTTATATGGAAAAAGG - Intronic
942184375 2:173410659-173410681 TTGTTTCCTCATCTGGAAATGGG - Intergenic
942438644 2:176008214-176008236 ATGTTCTTACATATGGAGAAAGG + Intergenic
942444489 2:176068981-176069003 ATGTTTTCTCATCTGTAAAATGG - Intergenic
942596739 2:177598809-177598831 CTCTTTTCACAGATGGAAAAAGG + Intergenic
942773602 2:179553091-179553113 ATGTTTTCACCTATACAATTTGG - Intronic
943047067 2:182872042-182872064 ATCTTTTCTCATAGGAAAATTGG + Intergenic
943156609 2:184187508-184187530 ATTTTTCCACATATGGGAGTGGG + Intergenic
943171983 2:184413476-184413498 ATAATTTCACAGATGGAAAATGG + Intergenic
943196258 2:184754306-184754328 ATGTTTTCACATATTGGTATAGG - Intronic
943487120 2:188499775-188499797 ATGTTTTAACATATGTAAATAGG - Intronic
943540262 2:189204979-189205001 AGTTTTTCACACCTGGAAATAGG + Intergenic
944008090 2:194936381-194936403 ATATTTTTTCCTATGGAAATGGG - Intergenic
944014953 2:195024889-195024911 ATGTGTTCTTATCTGGAAATAGG + Intergenic
944226266 2:197351486-197351508 ATGATTTCAGATGTGGATATTGG - Intergenic
945678323 2:212882141-212882163 GTGGTGTCACTTATGGAAATGGG + Intergenic
946414454 2:219532634-219532656 ATGGTTTCACATATGCATGTGGG + Intronic
947015883 2:225619186-225619208 TTGTTTACAAATATGGAAATTGG + Intronic
948243424 2:236457562-236457584 ATGGTATCATATATGGAAAAAGG + Intronic
948429093 2:237907920-237907942 TAGTATTTACATATGGAAATGGG + Intronic
948780228 2:240316678-240316700 ATATTTTCATATATGGTTATTGG - Intergenic
1169231622 20:3893142-3893164 CTGTTTTCTCATCTGGAAATTGG - Intronic
1171755690 20:29106267-29106289 ATCTTTTTAAATGTGGAAATAGG + Intergenic
1171945137 20:31369883-31369905 ATATTTACATATATGGATATGGG + Intronic
1172207652 20:33175747-33175769 CTGTTTTCACATCTGTAAACTGG + Intronic
1173950387 20:46988354-46988376 AAGTTTTCTCATCTGGAAAATGG - Intronic
1174048345 20:47749662-47749684 TTGTGTTCACAGATGGAAAGTGG + Intronic
1174252566 20:49230629-49230651 ATCTTTTCTCATTTGTAAATGGG + Intronic
1175416029 20:58801637-58801659 ATCTGTTCATTTATGGAAATGGG - Intergenic
1175674492 20:60935001-60935023 ATGCTTTCACATATTTAACTTGG - Intergenic
1176350552 21:5792141-5792163 ATATTTAGACATATTGAAATTGG - Intergenic
1176357366 21:5912725-5912747 ATATTTAGACATATTGAAATTGG - Intergenic
1176544873 21:8190211-8190233 ATATTTAGACATATTGAAATTGG - Intergenic
1176563824 21:8373256-8373278 ATATTTAGACATATTGAAATTGG - Intergenic
1177072913 21:16533398-16533420 ATGTGTTTACACATGGAAAAGGG + Intergenic
1177083101 21:16666671-16666693 ATGTTTTCAAAAATGTAAAGAGG + Intergenic
1177504672 21:22004833-22004855 TTGTTTTCGCATATGTAAAATGG + Intergenic
1177990679 21:28032064-28032086 ATGTTTTCACAAAAGAAAAATGG + Intergenic
1178002553 21:28178722-28178744 CTCTTTTCAGCTATGGAAATGGG + Intergenic
1178340630 21:31783158-31783180 ATGTTTTCACACAAGGAAGAGGG - Intergenic
1179006070 21:37516428-37516450 ATGTTTTCACGCAAGGAAACAGG - Intronic
1180153683 21:45966648-45966670 GTGTTATCACATATATAAATGGG + Intergenic
1182262318 22:29082928-29082950 AAGTTTTCACATAAGGATACAGG - Intronic
1182327838 22:29527473-29527495 TTTTTTACACAAATGGAAATAGG - Intronic
1182871288 22:33650153-33650175 CTGTTTTCCCATCTGAAAATGGG - Intronic
1182960778 22:34472939-34472961 AAATTTTAACAGATGGAAATTGG + Intergenic
1183126487 22:35786838-35786860 GTGATTTCACATATGAAATTGGG - Intronic
1183144599 22:35978178-35978200 ATATTTACAAATATGGAAAGAGG + Intronic
1183511645 22:38238872-38238894 TTTTTTTCACATTTGTAAATGGG + Intronic
1183592408 22:38787546-38787568 CAGTTTTCTCATCTGGAAATTGG + Intronic
1183738318 22:39656115-39656137 ATGTAATTACAGATGGAAATGGG + Intronic
1203249743 22_KI270733v1_random:106449-106471 ATATTTAGACATATTGAAATTGG - Intergenic
949516517 3:4812363-4812385 ATGTTTTAATATATGTATATGGG - Intronic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950180015 3:10904862-10904884 ATTTTTTCAGAAGTGGAAATAGG - Intronic
950222144 3:11204727-11204749 CTGTTTTCTCATTTGTAAATTGG - Intronic
950462534 3:13134038-13134060 GTGTTTTCAAATACGAAAATGGG + Intergenic
950484684 3:13266134-13266156 GTGTTTCCTCATATGGAAAATGG - Intergenic
950697233 3:14712041-14712063 ATATTACCACATTTGGAAATAGG + Intronic
950868391 3:16208096-16208118 ATGTTTTTCCATAAGGAATTAGG - Intronic
951025981 3:17830551-17830573 AAGATTTCACATATAGAAATTGG + Intronic
951280272 3:20739818-20739840 ATTATTTCAGATATGGAAAATGG - Intergenic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952180875 3:30915161-30915183 ATGTTTTCAAATAATGAAAAGGG + Intergenic
952209692 3:31217205-31217227 ATTTTTTTACATCTGGAATTTGG - Intergenic
953471881 3:43174441-43174463 TTGTTTGCAAATATGAAAATTGG + Intergenic
953743219 3:45554586-45554608 ATGTGAGCACATGTGGAAATGGG - Intergenic
954829208 3:53404330-53404352 ATCTCTTCAAATATGGAATTTGG - Intergenic
955807007 3:62747208-62747230 ATGTTTTAAAATCTGGAGATGGG - Intronic
955985518 3:64570064-64570086 ATGTTTTAAAATATTAAAATTGG - Intronic
956148743 3:66219357-66219379 ATGTTGTCACGTATGGCAAAAGG + Intronic
956822585 3:72967179-72967201 CTGTTTTCTCATCTGTAAATGGG - Intronic
956986343 3:74705600-74705622 ATGTTTTCACATGTAGAAACTGG - Intergenic
957165601 3:76669081-76669103 ATGTTTAAACATATGAAAACAGG + Intronic
957185517 3:76936662-76936684 ATGTTTCCAGATATGCAATTGGG + Intronic
957724969 3:84052233-84052255 TTTTTTTGACATTTGGAAATAGG - Intergenic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
957808130 3:85178732-85178754 ATGATTTAACATATACAAATAGG - Intronic
958846489 3:99271194-99271216 AGGTTTTAACATATGAATATGGG - Intergenic
958952461 3:100431108-100431130 CTGTTCTCACATCTGGAAACTGG - Intronic
959321557 3:104882447-104882469 TTGTTTTAACATCTGGAAATGGG - Intergenic
959795576 3:110424151-110424173 ATGTAACCATATATGGAAATAGG + Intergenic
960196506 3:114775221-114775243 TTGTTCTAACATATGAAAATTGG - Intronic
960449690 3:117791151-117791173 AAATATTCCCATATGGAAATGGG - Intergenic
963422587 3:145079149-145079171 ATCTTTAGACACATGGAAATAGG - Intergenic
963439146 3:145314988-145315010 ATATTTGCTCATATGGAGATAGG - Intergenic
963626996 3:147685905-147685927 ATGTTTTCAAATATATTAATAGG + Intergenic
963821643 3:149902141-149902163 ATGAATTCACATATGAAAAAGGG + Exonic
963860416 3:150304034-150304056 TTGTTTTCCACTATGGAAATGGG + Intergenic
964593676 3:158396931-158396953 TTGTTTTCTCATATGTAAAATGG - Intronic
965064102 3:163822974-163822996 TTATTTTGACATATGGAATTTGG + Intergenic
965313315 3:167159039-167159061 ATGTATGCAGATATGGAGATGGG - Intergenic
965667961 3:171116087-171116109 ATGTTACCACACATAGAAATAGG + Intronic
965878430 3:173357475-173357497 TTGTTTTCTAATATGTAAATCGG - Intergenic
966055721 3:175686966-175686988 TTGTTTTCTCATCTGAAAATGGG - Intronic
966513087 3:180785687-180785709 ATGTCTTCACCTAAGGCAATTGG + Intronic
967688251 3:192442768-192442790 TTGTTTTCAGATAGAGAAATGGG + Intronic
967722314 3:192828489-192828511 CTGTTTTCTCATTTGGAAAATGG + Intronic
967859876 3:194142356-194142378 AAGTTTTCAAATATACAAATTGG + Intergenic
969169837 4:5352280-5352302 ATGGTTCAACATATGCAAATCGG + Intronic
969218334 4:5741396-5741418 TTTTCTTCACACATGGAAATGGG + Intronic
970503708 4:16705326-16705348 ATTTTTTCACCTATTGAAGTTGG + Intronic
970711243 4:18865407-18865429 ATATTTTCAAATGTGAAAATAGG + Intergenic
971229009 4:24782623-24782645 ATGGGTTCAGATATGGAAACAGG + Intergenic
971657416 4:29367468-29367490 ATGCTTTTACATGGGGAAATTGG - Intergenic
971957715 4:33443678-33443700 ATGTTTTCTTATATGTAAAGTGG - Intergenic
972273434 4:37534838-37534860 ATGTTTCAACATATGGATTTTGG + Intronic
972401310 4:38706327-38706349 TTCTTTTTACAGATGGAAATTGG + Intergenic
972804253 4:42511775-42511797 ATGTTTGCTAATATGGAAATAGG - Intronic
973252124 4:48071536-48071558 ATGACTTCATATATGGACATTGG + Exonic
973705279 4:53574723-53574745 CTGTTTTCACATCTGTAAAATGG + Intronic
974225669 4:59039620-59039642 ATGTGTTCACAGATGGAAAAAGG - Intergenic
974297554 4:60021745-60021767 ATTTTTTGACATATGAAATTAGG + Intergenic
974558373 4:63482477-63482499 AGGTTCTTACATATGAAAATGGG + Intergenic
975930291 4:79513139-79513161 ATTTCTTCACATAATGAAATGGG - Intergenic
976169459 4:82287863-82287885 ATGTTTGCACACAAGCAAATTGG + Intergenic
976505035 4:85836601-85836623 ATGTGGTCATATTTGGAAATAGG - Intronic
976911369 4:90310638-90310660 CTGTTTTCACATTTGTAAAATGG - Intronic
977880518 4:102199087-102199109 ATATTTCCACATATGGATTTTGG + Intergenic
978014097 4:103722588-103722610 ATTTTTTCACATTAAGAAATAGG + Intergenic
978353827 4:107849026-107849048 TTTTTTTTACATATGGAAGTCGG + Intronic
978569860 4:110125151-110125173 ATTTTTTAAAAAATGGAAATGGG - Intronic
978576106 4:110191526-110191548 AATTTTTCACATATGGACACAGG - Intronic
978989336 4:115059332-115059354 ATGTCTACAAATATGGAGATGGG - Intronic
979574311 4:122269199-122269221 ATGTTTTCATATATATAACTAGG + Intronic
979597544 4:122550923-122550945 AAGTTTTCACAGAGGGCAATAGG + Intergenic
979813424 4:125067315-125067337 ATGTTTTCACACATCGATACAGG + Intergenic
980023212 4:127733638-127733660 ATGTTTTAAAATAAGGAAGTTGG - Intronic
980297305 4:130938327-130938349 ATGTTTTAACATATGCAAATTGG - Intergenic
981137945 4:141234782-141234804 GTTTTCACACATATGGAAATAGG + Intergenic
981214780 4:142151415-142151437 GTATTTTTACATAAGGAAATAGG - Intronic
981349601 4:143714009-143714031 AGGATTTCACATATAGCAATGGG - Intergenic
981491097 4:145340323-145340345 CTGTTTCCACATTTGAAAATGGG + Intergenic
981985277 4:150846816-150846838 CTGTTCTTATATATGGAAATGGG - Intronic
982214446 4:153068217-153068239 ATGTGTTTATATTTGGAAATAGG - Intergenic
982403713 4:154997664-154997686 ATGTTTCCACATATGAATTTTGG + Intergenic
982619112 4:157680607-157680629 AGATTTTGACAGATGGAAATTGG + Intergenic
982791648 4:159599031-159599053 ATGTTATCATAATTGGAAATTGG - Intergenic
983207042 4:164921325-164921347 ATGTTTTTCCATTTGGAAGTTGG + Intergenic
983855816 4:172642775-172642797 ATGTTTATACATAGTGAAATGGG - Intronic
983977343 4:173951818-173951840 ATATTTTCCCTTATAGAAATTGG - Intergenic
984152944 4:176157040-176157062 ATGTAACCATATATGGAAATAGG - Intronic
984226417 4:177040719-177040741 AGGTTTTCACATATGTACATTGG - Intergenic
984291622 4:177802683-177802705 ATGTTTTGCCATTTGGAAAATGG - Intronic
984331497 4:178326143-178326165 GTGTTTTAAAATATGGACATGGG + Intergenic
984507773 4:180640891-180640913 ATGTTTTCTCATCTGTAAAATGG - Intergenic
985262629 4:188128926-188128948 TTGTTTTCTCATCTGTAAATGGG + Intergenic
986037382 5:3953045-3953067 ATGTTGTCACTAATGGAAATGGG + Intergenic
986068655 5:4260836-4260858 ATGTTTTCTTATTTGGAGATAGG + Intergenic
986264359 5:6180261-6180283 CTGTTTTCTCATCTGCAAATTGG - Intergenic
986815114 5:11400716-11400738 ATGTTTTCACATGTATGAATTGG + Intronic
986962617 5:13234009-13234031 AAGTTTTAAAATATGTAAATAGG - Intergenic
987366102 5:17150622-17150644 ATGTTCTGACATCTGGAATTCGG - Intronic
987538333 5:19217778-19217800 ATGTTTTCATTTATGTAATTTGG - Intergenic
987591343 5:19931671-19931693 AACTTTTCATATATAGAAATGGG + Intronic
987613516 5:20241549-20241571 ATGTATTAAGATATAGAAATCGG + Intronic
987811582 5:22843228-22843250 GTGTTTTCACAGATAGAATTGGG - Intronic
987982796 5:25109328-25109350 ATGTACTCACATATAGAAAAAGG + Intergenic
988244358 5:28659981-28660003 ATGTTGTCTCACTTGGAAATAGG - Intergenic
988403796 5:30797800-30797822 ATGTTTTCACATATTAAAGCAGG + Intergenic
988699920 5:33663109-33663131 GTGTTTTCACAAAAGGAAACTGG - Intronic
989091152 5:37733333-37733355 ATGTTCTCTCATTTGGAAAAAGG - Intronic
989983503 5:50668614-50668636 CGGTTTTCACGTATAGAAATTGG + Intronic
990024566 5:51169646-51169668 ATGATTTCACATATGAAAACAGG - Intergenic
990957879 5:61361967-61361989 ATGTTTTCACATATGGAAATAGG + Intronic
991613382 5:68471065-68471087 ATGTTTGCTCATCTGGAAAATGG - Intergenic
991943274 5:71875759-71875781 AAGTTTTAACATATGAATATTGG - Intergenic
992064783 5:73096540-73096562 AGGTGTTCACATATCCAAATTGG - Intergenic
992583609 5:78208556-78208578 ATGGGTCCACATCTGGAAATTGG - Intronic
993274335 5:85837059-85837081 ATATTTACACATATGTACATGGG + Intergenic
993347306 5:86800257-86800279 CTGTTTTCACAAATGCAAAGTGG - Intergenic
993443720 5:87987086-87987108 ATGTTCTCTCATAAGGAAAAAGG + Intergenic
993564010 5:89450133-89450155 ATTATTTCATAAATGGAAATAGG + Intergenic
993974974 5:94468247-94468269 ATGTTTCCTCTTATGCAAATTGG - Intronic
994040502 5:95254354-95254376 GAGTTTTCTCATCTGGAAATTGG - Intronic
994630059 5:102274403-102274425 ATGTTTTGACATATGGTATGTGG - Intronic
994813365 5:104551931-104551953 ATGTTTTCACATGAAGAAGTTGG - Intergenic
995216055 5:109595812-109595834 GTGTTTTCACATAAGGTAAAAGG + Intergenic
995751905 5:115460822-115460844 AATTTTTCACATGAGGAAATAGG - Intergenic
995794496 5:115927224-115927246 CTGTTTTCTCATCTGTAAATAGG + Intergenic
995976918 5:118048856-118048878 CTGTTTTCTCATGTGTAAATGGG - Intergenic
996189179 5:120517462-120517484 ACCTTTTCACATATAGAAATGGG + Intronic
996244533 5:121245031-121245053 ATCTTTTCACAAAAGAAAATAGG + Intergenic
996928098 5:128853052-128853074 ATGTTACCTCATTTGGAAATAGG - Intronic
996990352 5:129622977-129622999 GTATTTTCTTATATGGAAATGGG + Intronic
997697172 5:135870800-135870822 CTCTTTTAACATAAGGAAATGGG + Intronic
998167268 5:139851474-139851496 TTGTTTTCCCATATGAAAAATGG + Intronic
998545607 5:143024714-143024736 CAGTTTTCACATCTGTAAATGGG - Intronic
999457813 5:151732498-151732520 CTGAGTTCACATAGGGAAATGGG - Intergenic
999600438 5:153257071-153257093 TTGTTTTCTCATCTGAAAATGGG - Intergenic
999630463 5:153565673-153565695 ATGATTTCATATATAGAAAATGG - Intronic
1000298385 5:159932955-159932977 ATATTTACTCATGTGGAAATTGG - Intronic
1000527706 5:162379229-162379251 GTGTTTTTACATATGAATATTGG + Intergenic
1000669198 5:164039602-164039624 AGATTTTCACATATGAAATTTGG + Intergenic
1001136955 5:169110639-169110661 ATGTTACCTCATTTGGAAATAGG - Intronic
1001235665 5:170027281-170027303 AGGTTTCCACATCTGGAACTAGG + Intronic
1001605056 5:172953704-172953726 AAGTTTTCACAAATGGTGATTGG + Intergenic
1001913815 5:175542791-175542813 CTGTTTTCTCATCTGCAAATGGG + Intergenic
1002387980 5:178884275-178884297 AGGCTTTCACACATGCAAATCGG - Exonic
1002463851 5:179393895-179393917 ATGTGCTCTCATATGGAACTTGG + Intergenic
1002836173 6:867004-867026 CTGTTTTCAGATCTGTAAATGGG - Intergenic
1003428694 6:6019036-6019058 GTGTTTTGACAGATGCAAATTGG + Intergenic
1005360495 6:25027073-25027095 TTGTTTTAATATTTGGAAATTGG - Intronic
1006407836 6:33855601-33855623 ATGTTATCAAAGATGGGAATGGG - Intergenic
1007053788 6:38860970-38860992 TTTTTTTCAGATGTGGAAATTGG + Intronic
1008010108 6:46457400-46457422 CTGTTTTCCCATCTGTAAATTGG - Intronic
1008249548 6:49222859-49222881 ATGTTTTAATCTATGAAAATTGG - Intergenic
1008483540 6:52010946-52010968 ATTTTTTCACAGTTGGAATTAGG - Intronic
1008490385 6:52080315-52080337 ATTTTTTGAAACATGGAAATGGG - Intronic
1009521877 6:64693279-64693301 ATGTTTTTAAAAATAGAAATTGG + Intronic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1010408352 6:75531976-75531998 TTGTTTTCACATATGTGAAATGG - Intergenic
1010768252 6:79800331-79800353 CTATTTTCACATCTGGCAATTGG - Intergenic
1011385324 6:86790870-86790892 CAGTTTTCCCATATGAAAATCGG - Intergenic
1012121614 6:95374570-95374592 ATGTTCTCACTTATATAAATGGG + Intergenic
1012272755 6:97235250-97235272 AGGTTTTTGCATAAGGAAATAGG + Intronic
1012444321 6:99292661-99292683 CAGTTTTCCCATCTGGAAATGGG + Intronic
1013412359 6:109893317-109893339 ATGTATTAATATAAGGAAATTGG + Intergenic
1014416212 6:121187859-121187881 ATGTTTTCACAAATATGAATAGG + Intronic
1015015221 6:128404730-128404752 ATGATTTCACAGATGAAAAGAGG + Intronic
1015228382 6:130884948-130884970 ATGTTTTCAAATATGCATAGTGG - Intronic
1015330321 6:131970605-131970627 GTGTGTTTACATATGGAAAGAGG + Intergenic
1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG + Intergenic
1015782637 6:136885733-136885755 ATGTAGTCACAAATGTAAATAGG + Intronic
1016628351 6:146198848-146198870 ATGTTTCCAGATCTGAAAATTGG + Intronic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1017333418 6:153226194-153226216 ATCTTTACACATTAGGAAATTGG - Intergenic
1017739008 6:157388708-157388730 ATTTTTTAAAAGATGGAAATTGG - Intronic
1018537144 6:164833163-164833185 GTGTTTTCTCATGTGGGAATGGG - Intergenic
1020474590 7:8580856-8580878 ATATTTTAACATCTGGAACTTGG + Intronic
1020547009 7:9544836-9544858 ATGATTCAACATATGCAAATCGG + Intergenic
1021858529 7:24882050-24882072 ATGTTACCACATTTGGAAAAAGG - Intronic
1022013824 7:26331187-26331209 ATGTATTAACATAAAGAAATGGG + Intronic
1022176765 7:27878568-27878590 ATCTTTACATATATGGAATTTGG - Intronic
1022617102 7:31942817-31942839 TTGTTTTCATATATGTGAATCGG - Intronic
1022881687 7:34594631-34594653 CTGTTTTCACATTTGTAAAATGG + Intergenic
1022904931 7:34846536-34846558 ATGTTTTTACACATTAAAATTGG - Intronic
1023388833 7:39687787-39687809 CTGTTTTCACATCTGTAAAATGG - Intronic
1024113988 7:46174739-46174761 ATGTTTTTATATATGTAACTTGG - Intergenic
1025164204 7:56696572-56696594 ATGTTCTGACTTATGGCAATTGG - Intergenic
1028716078 7:93970710-93970732 ATGTGTTCACAAATGTAATTGGG + Intronic
1028805087 7:95016890-95016912 ATGTATTCTTATCTGGAAATAGG + Intronic
1028981979 7:96977363-96977385 ATTTATTCACATATGGAAGGTGG + Intergenic
1029731437 7:102440850-102440872 TTGTTTTCACATAAGGAAACAGG - Intronic
1030150434 7:106399006-106399028 ATGTGGTCATATTTGGAAATAGG + Intergenic
1030862122 7:114646132-114646154 ATGTATTCACATGAGGAAATGGG - Intronic
1033999874 7:147400114-147400136 AGGTTTTCACACCTGGAAAGAGG - Intronic
1034324254 7:150216349-150216371 ATTTTTACACATCTGGAAAAGGG - Intergenic
1034768939 7:153752882-153752904 ATTTTTACACATCTGGAAAAGGG + Intergenic
1035006921 7:155670606-155670628 CTGTTTTCACATTTTGAAAATGG + Intronic
1035889901 8:3331813-3331835 AAGTTTACACATAAAGAAATAGG - Intronic
1036130605 8:6106000-6106022 AGGAATTCACATGTGGAAATAGG + Intergenic
1036195684 8:6711959-6711981 ATGTTTTCTTATTTGGAAAAAGG - Intronic
1037597127 8:20363582-20363604 ATGTGTTCGTATTTGGAAATAGG + Intergenic
1037914412 8:22764070-22764092 ATGATTTCACATAAGGAACATGG - Intronic
1038348111 8:26750607-26750629 ATGTTTTAACATATGGATTTTGG + Intronic
1039022905 8:33227173-33227195 AACTTCTCACATATGGAATTGGG - Intergenic
1039555026 8:38468996-38469018 CTGTTTTCCCATCTGTAAATGGG + Intergenic
1040756861 8:50786574-50786596 GTGTTTTGAAATATGGAACTGGG - Intronic
1040977547 8:53210925-53210947 ATAAATTCACATAGGGAAATAGG + Intergenic
1041022219 8:53649215-53649237 ATATTTTCAGATGTGCAAATGGG + Intergenic
1043993910 8:86789345-86789367 ATGTTTTCAGATGAGAAAATGGG + Intergenic
1044205072 8:89484262-89484284 ATATTTTCTCATCTGTAAATGGG - Intergenic
1044328709 8:90891525-90891547 ATTTTTTTATATATGGGAATAGG - Intronic
1044454278 8:92374719-92374741 ATGTTTTTACCTATGTAATTTGG + Intergenic
1045669403 8:104531220-104531242 ATTTTTGCATATATTGAAATAGG - Intronic
1046673992 8:117088757-117088779 ATGATTTCACAGATGGTGATGGG + Intronic
1046769157 8:118101197-118101219 CAGTTTCCACATCTGGAAATGGG - Intronic
1047260208 8:123250970-123250992 TTGTTTCAACATATGTAAATAGG + Intronic
1047418047 8:124682014-124682036 CTGTTTTCTCATCTGTAAATTGG - Intronic
1047437174 8:124844388-124844410 ATGTGATCATATTTGGAAATAGG + Intergenic
1047797775 8:128275486-128275508 ATGATTTTACATTTGAAAATGGG - Intergenic
1047852335 8:128870489-128870511 ATGTTTCCTCATCTGGAAAACGG - Intergenic
1048543678 8:135366177-135366199 ATTTTTTCACATAAGCAAACAGG + Intergenic
1048631301 8:136245792-136245814 ATGGTTTAACATATGCACATCGG - Intergenic
1048901992 8:139047638-139047660 ATTTTTACACATAAAGAAATTGG - Intergenic
1049967217 9:790617-790639 ATGTGATCTCATTTGGAAATAGG - Intergenic
1050176774 9:2876671-2876693 ATGTTTTTATATATTGGAATTGG + Intergenic
1050795788 9:9539886-9539908 ATGGTATCACATTTGGAAAAGGG - Intronic
1050833437 9:10044407-10044429 ATGTTTTCAGATGTAAAAATTGG + Intronic
1051046941 9:12886962-12886984 CTGTTTTGACATATGGAGAAAGG - Intergenic
1051160978 9:14207143-14207165 AAGTTTTCTCATCTGAAAATGGG - Intronic
1051197287 9:14576674-14576696 GTGTTGTCACAAATGAAAATAGG - Intergenic
1051753068 9:20365057-20365079 AGGCTTTGACATAGGGAAATAGG - Intronic
1052246276 9:26339446-26339468 ATCATTTCACATTTAGAAATAGG + Intergenic
1053326455 9:37156840-37156862 ATGTTTTAACATAAGAACATTGG - Intronic
1053754520 9:41291322-41291344 ATGATTTAAGATGTGGAAATTGG - Intergenic
1054260040 9:62855658-62855680 ATGATTTAAGATGTGGAAATTGG - Intergenic
1055003592 9:71481381-71481403 TTGTTTTCTCATTTGTAAATGGG + Intergenic
1055293265 9:74806690-74806712 ATGTTTTCTCATCTATAAATGGG - Intronic
1055517086 9:77044196-77044218 ATTTTTTCAGAGATGGAACTGGG + Intergenic
1055663958 9:78534716-78534738 ATGATTTGACATATGGGTATAGG - Intergenic
1055733039 9:79298663-79298685 ATCTGTTAACTTATGGAAATGGG - Intergenic
1055890671 9:81120655-81120677 ATGTTTTCTCATCTGTAAAATGG + Intergenic
1056246630 9:84701850-84701872 GTGTTTTCACATATGTACACTGG + Intronic
1056424148 9:86459708-86459730 ATATTTTCAAAAATGGAAACTGG + Intergenic
1058136147 9:101309706-101309728 CTGCTTTCACATCTGTAAATGGG - Intronic
1058506111 9:105667710-105667732 AAGTTTTCACATTTTGAAAGTGG - Intergenic
1058739326 9:107927368-107927390 CTGTTTTCTTATATGCAAATTGG + Intergenic
1058960260 9:109986069-109986091 ATGTTTTCAGATCTGGATTTTGG - Intronic
1059293342 9:113247227-113247249 ATGTTTTCACAAATCTAAAAAGG + Intronic
1059597506 9:115738198-115738220 ATGTTTTCATACATTCAAATAGG - Intergenic
1059618799 9:115980594-115980616 CTGTTTTCTCACATGTAAATTGG + Intergenic
1060073237 9:120569259-120569281 ATGTTTCCACATCTAGAAAGGGG - Intronic
1060214618 9:121731293-121731315 CTGTTTTCACATCTGTAAAATGG + Intronic
1060317122 9:122522457-122522479 ATTTTGTCACAGATGGAAAGTGG + Intergenic
1060758779 9:126231642-126231664 TTGTTTTTCAATATGGAAATGGG - Intergenic
1061035391 9:128111131-128111153 ATGTTTTCATTTAGGGAAAGGGG - Intergenic
1061400218 9:130364499-130364521 ATGTTTCCACCGAGGGAAATTGG - Intronic
1061495446 9:130971321-130971343 CTGTTTTCTCATCTGGAAGTGGG + Intergenic
1203466141 Un_GL000220v1:89711-89733 ATATTTAGACATATTGAAATTGG - Intergenic
1185947777 X:4396999-4397021 ATGTGACCACATTTGGAAATAGG + Intergenic
1186282829 X:8012566-8012588 TTGTTTCCACATATGTAAATAGG + Intergenic
1186292049 X:8110959-8110981 ATGTCTTCACGTATAGGAATGGG + Intergenic
1186385989 X:9110605-9110627 AGGTTTTTGGATATGGAAATAGG - Intronic
1186688747 X:11952550-11952572 AAGCTTTCACATCTGGAAAAGGG - Intergenic
1186808618 X:13164770-13164792 ATGTTTTCACATGGGTGAATTGG - Intergenic
1187684415 X:21802118-21802140 ATATGCTCACATATGGAAAATGG + Intergenic
1187736367 X:22308220-22308242 ATGTATTCACATATGCCTATAGG - Intergenic
1188415454 X:29927675-29927697 ATGTTTTAGCCTATGCAAATAGG + Intronic
1188787888 X:34371244-34371266 ATGTGATCTCATTTGGAAATAGG + Intergenic
1188980033 X:36719316-36719338 TATTTATCACATATGGAAATTGG + Intergenic
1189392588 X:40589031-40589053 TTGTTTTCCGAAATGGAAATTGG + Exonic
1189460353 X:41237627-41237649 GTCTTTTCACATCTGGAAATAGG + Intergenic
1190970040 X:55339855-55339877 ATGCTGTCAAATATGGAATTTGG - Intergenic
1191920857 X:66255526-66255548 CTGTTTTCTCATCTGGAAAATGG + Intronic
1193104811 X:77658648-77658670 CTGTTTTCACATATGTACAATGG - Intronic
1193679327 X:84499030-84499052 ATGTTTTCTCATTTGTAAAATGG + Intronic
1194087812 X:89550875-89550897 ATGATCTCACATGTGTAAATTGG - Intergenic
1194430218 X:93794592-93794614 ATGTTTTCATTTCTGGAAATGGG - Intergenic
1194475006 X:94347684-94347706 ATGTTATCTCATTTGGAAAAGGG - Intergenic
1195385154 X:104307015-104307037 CTGTTTTCCCATTTGGAAAATGG + Intergenic
1195486444 X:105413286-105413308 ATGTTATGTTATATGGAAATGGG + Intronic
1195883483 X:109616862-109616884 ATGTTTTGGCATAAGCAAATGGG + Intergenic
1195970356 X:110466372-110466394 CTGTTTTCACATCTCTAAATTGG - Intergenic
1196192342 X:112808233-112808255 CTGTTTTCTCATATGCAAATTGG - Intronic
1197080228 X:122403916-122403938 ATTCTTTCACTTTTGGAAATGGG + Intergenic
1197958642 X:131979974-131979996 CTGTTTTCTCATATGTAAACTGG + Intergenic
1198506674 X:137308260-137308282 CTGTTTTCTCATATGTAAAATGG + Intergenic
1200440810 Y:3209929-3209951 ATGATCTCACATGTGTAAATTGG + Intergenic
1200758880 Y:7017531-7017553 ATGTTTTCAAATTTAGAAAGGGG - Intronic
1202603017 Y:26613722-26613744 ATATTTTCACATAAGGTCATGGG - Intergenic