ID: 990957996

View in Genome Browser
Species Human (GRCh38)
Location 5:61363083-61363105
Sequence ATGTTTTTAGAGATGTTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 369}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990957992_990957996 15 Left 990957992 5:61363045-61363067 CCCACTATTTGAAAAACACTGTT 0: 1
1: 3
2: 20
3: 97
4: 1061
Right 990957996 5:61363083-61363105 ATGTTTTTAGAGATGTTGTAGGG 0: 1
1: 0
2: 0
3: 33
4: 369
990957993_990957996 14 Left 990957993 5:61363046-61363068 CCACTATTTGAAAAACACTGTTC 0: 1
1: 4
2: 11
3: 70
4: 588
Right 990957996 5:61363083-61363105 ATGTTTTTAGAGATGTTGTAGGG 0: 1
1: 0
2: 0
3: 33
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990957996 Original CRISPR ATGTTTTTAGAGATGTTGTA GGG Intronic
901254902 1:7815108-7815130 GTATTTTTAGAGATGAAGTATGG - Intronic
902143727 1:14379108-14379130 ATGTGTCTAGAAATGTTGTCTGG - Intergenic
902851056 1:19157233-19157255 ATGATTTTAGAGTTGTTTGAAGG + Intronic
903866559 1:26402839-26402861 TTGTTTTTAGAGATGAGGTCTGG - Intergenic
904071129 1:27798339-27798361 ATTTTTGTAGAGATGTTGCCCGG - Intronic
908030226 1:59991275-59991297 ATGTATTTATAGATGTTCTTTGG + Intronic
908435740 1:64104127-64104149 ATGTTTTAAGAAATGTCCTAAGG - Intronic
908673129 1:66570953-66570975 ATGATTTTACAAATGCTGTATGG - Intronic
911035413 1:93539938-93539960 ATGTTTTAAGAGAAGGTGTTGGG - Intronic
911554550 1:99327650-99327672 AGGTTTTTAGAGATGATGTTTGG - Intergenic
912020663 1:105105917-105105939 ATGTTTTAAGATATTTTGTTAGG + Intergenic
912036685 1:105325024-105325046 GTGTGTTTAGAAATGTTGTCTGG + Intergenic
912143248 1:106757704-106757726 ATATTTTTAGACTTGTTGAATGG + Intergenic
916866890 1:168869415-168869437 ATGTTTCTGGAGTTGCTGTATGG - Intergenic
918922007 1:190724658-190724680 ATGTTTTAAGATGTGTTTTAGGG + Intergenic
921929077 1:220739521-220739543 ATGTTTCAAGACATGTTTTATGG + Intergenic
922036590 1:221854188-221854210 TTGCTTTGAGAGATGCTGTAGGG + Intergenic
922094665 1:222432854-222432876 ATGTTTTTAAGGTAGTTGTATGG + Intergenic
923150302 1:231227236-231227258 ATGTTGTGAGAGATGGTGTATGG - Intronic
923191551 1:231625679-231625701 TTATTTTTAGAGATGTGGTGGGG + Intronic
923883211 1:238126775-238126797 ATGTTTTTAGAGGTGATGACTGG + Intergenic
924835849 1:247646438-247646460 AGAGTTTTAGAGATGTTGAAGGG - Intergenic
1064416311 10:15153250-15153272 ATTTTTTTAGAGATGGCGGAGGG - Intronic
1065910167 10:30296117-30296139 ATTTTCTTCTAGATGTTGTATGG - Intergenic
1067928262 10:50533147-50533169 CTGTTTTTAGAAAAGTTATATGG - Intronic
1068850433 10:61732946-61732968 ATGTTTTTAGAGCTTTTATTGGG + Intronic
1069124899 10:64618356-64618378 ATTTATTTATAGAGGTTGTATGG + Intergenic
1069165337 10:65151071-65151093 ATATTTTTGTATATGTTGTAAGG - Intergenic
1070092999 10:73307692-73307714 ATATGTTTATAAATGTTGTATGG - Intronic
1071172124 10:82878768-82878790 ATGCTTTTATGGATGTTTTAAGG - Intronic
1071981913 10:91011930-91011952 ATTTTTTCACAGATGTTGGAAGG - Intergenic
1072223080 10:93344126-93344148 ATGGTTTTAGACATTTTCTAGGG + Intronic
1073238845 10:102040411-102040433 ATTTTTTTAGAGCTGTTTTTAGG - Intronic
1076472090 10:130726053-130726075 GTATTTATAGAGATGTTTTAAGG - Intergenic
1077448925 11:2622724-2622746 ATATTTTTAGAGCAGTTTTAGGG + Intronic
1078502298 11:11892631-11892653 ATTTTTGTAGAGATGGTGTCTGG - Intronic
1078625340 11:12950714-12950736 ATGTTTTTGGAAAGGTTGCAAGG + Intergenic
1078680059 11:13467094-13467116 ATGTTTATAGAAATGTTGTGTGG - Intergenic
1078936430 11:15955167-15955189 ATTTATTTAAAGATATTGTACGG + Intergenic
1080128813 11:28769073-28769095 ATGTTATTATTGATATTGTAAGG - Intergenic
1080489876 11:32751089-32751111 ATGTGTCTAGAAATGTTGTCTGG + Intronic
1080830711 11:35890984-35891006 ATTTTTTTAGAGATGGTGTCTGG + Intergenic
1081292672 11:41345970-41345992 ATGTTTTTCCAGAATTTGTAGGG + Intronic
1081986863 11:47311421-47311443 GTGTTTTTAGAGCCCTTGTAGGG + Intronic
1085222507 11:74887040-74887062 TTGTTTTTGTAGATGGTGTAAGG - Intronic
1085223422 11:74895893-74895915 GTGTGTTTAGAAATGTTGTCAGG - Intronic
1086036813 11:82425603-82425625 AGGCCTTTAGAGATGTGGTAAGG - Intergenic
1086249770 11:84798849-84798871 ATGTGTCTAGAAATGTTGTCTGG + Intronic
1087596337 11:100258820-100258842 ATGTTTTTGCAGAGGCTGTATGG - Intronic
1087666245 11:101052516-101052538 ATGTGTTTAGAGATGTAGGCTGG + Intronic
1088072995 11:105812749-105812771 ATATTTTTATAGATTTTGGAAGG + Intronic
1089059286 11:115613051-115613073 ATGTCTTAAGAGTTGTTGTGAGG + Intergenic
1089964076 11:122641072-122641094 TTTTCTTAAGAGATGTTGTAGGG - Intergenic
1090870035 11:130736256-130736278 ATATTTTTAGTGATATTTTATGG - Intergenic
1091672021 12:2458631-2458653 ATGAGTTTGGAGATGGTGTAAGG + Intronic
1093099438 12:15009945-15009967 TTATTTTAAGAGAAGTTGTATGG + Intergenic
1093154004 12:15658382-15658404 TTGTTTTTATAGATTTTGTGGGG - Intronic
1093355006 12:18156077-18156099 ATCTTTTTAAAGATGTGGTCAGG + Intronic
1094657941 12:32438906-32438928 ATATTTTAAAACATGTTGTAGGG - Intronic
1094812216 12:34149600-34149622 ATGTATCTGGAGATTTTGTAGGG - Intergenic
1095880211 12:47127735-47127757 ATTTATTTAGATATGTTTTATGG + Intronic
1096445288 12:51684931-51684953 ATGGATTTAGTGATGTTGCATGG + Intronic
1097464288 12:59903259-59903281 ATATTTTTAGAGGTGTTGAAGGG - Intergenic
1097692811 12:62749096-62749118 ATGTTTTAAGAGAAGTAGTAAGG - Intronic
1098236851 12:68425650-68425672 ATGTATTTAGAGAAGTTTTGTGG - Intergenic
1099071654 12:78051918-78051940 ATGTTTTTATACATGTTCTATGG + Intronic
1099645706 12:85352976-85352998 CTGTTTTCTGAGATGTTCTATGG - Intergenic
1099771734 12:87068293-87068315 ATTTTTGTAGAGATATTTTATGG - Intergenic
1099983724 12:89638078-89638100 AAATTTTTAGAGAAGTTATAGGG + Intronic
1100207466 12:92366393-92366415 AGGTTTTTAGAAATATTCTATGG - Intergenic
1101252023 12:102946033-102946055 ATGTGTCTAGAAATGTTGTCTGG + Intronic
1101330447 12:103753566-103753588 CTGCCTTCAGAGATGTTGTAAGG - Intronic
1101469226 12:104980654-104980676 ATGTTTTTTGACTTGTTTTATGG + Intergenic
1104691784 12:130832022-130832044 ATTTTTTTAGAGATGAGGTCTGG + Intronic
1107264398 13:38535622-38535644 ATGATTATAGAGGTGATGTATGG + Intergenic
1107768537 13:43764239-43764261 ATGTTTTTGTAGATGTTTCAGGG - Intronic
1108893892 13:55298350-55298372 TTGTTTGTTGAGAGGTTGTAAGG - Intergenic
1109013635 13:56980783-56980805 ATATTTTTAGGGATGTTTAATGG + Intergenic
1109044484 13:57391762-57391784 ATGTTTTTAGATATTTTGTGAGG + Intergenic
1109062933 13:57642493-57642515 ACTTGTTTAGAGAAGTTGTAAGG - Intronic
1109132571 13:58606663-58606685 ATTTTTTTTCAGATTTTGTAAGG + Intergenic
1109790434 13:67240698-67240720 ATGAGTTTAGAAAAGTTGTAGGG + Intergenic
1109974028 13:69807607-69807629 GAGTGTTTAGAGATGTTGTTTGG + Intronic
1110873828 13:80485207-80485229 ATGATTTTATAGATATTGGAGGG - Intergenic
1111047655 13:82835670-82835692 ATTTTTTTAGAGATGGAGTCTGG - Intergenic
1111134675 13:84025603-84025625 ATGTTTTTAAATAAATTGTAAGG + Intergenic
1111421422 13:88016785-88016807 ATTTTTTTAGAAATTTAGTACGG + Intergenic
1111552976 13:89839765-89839787 ATATTTTTAGAGATTGTGTTTGG - Intergenic
1112113099 13:96324188-96324210 AAGTTTTTGGAGATGTTTAAAGG - Intronic
1113062127 13:106333626-106333648 ATATTTTTAGATTTGTTTTATGG - Intergenic
1114896938 14:27002540-27002562 ATATTTTTAGAGAAGCTTTAAGG - Intergenic
1115536795 14:34380961-34380983 CTGTCTTTAGAGATTTGGTAAGG + Intronic
1115830194 14:37329215-37329237 ATGTTCTTAAAGTTGTTTTATGG - Intronic
1116157941 14:41232009-41232031 AAGTTTTTAAAGATATTTTACGG - Intergenic
1116328705 14:43568286-43568308 ATAGGTTTAGAGATGTTGTAGGG - Intergenic
1116832629 14:49737287-49737309 AAGTCATTAGAGATGTTGTTTGG - Intronic
1118543514 14:66858388-66858410 GTGTGTTTAGAAATGTTGTCCGG - Intronic
1119420311 14:74504214-74504236 ATACTCTTAGAGTTGTTGTAAGG + Intronic
1120340711 14:83217447-83217469 ATGTGTTTAGAAATGTTTTATGG + Intergenic
1121993539 14:98584091-98584113 CTGCTTGTTGAGATGTTGTAGGG - Intergenic
1122014403 14:98781839-98781861 ATGTTGTTAGAGAGGATGTAAGG + Intergenic
1123779895 15:23615834-23615856 ATGTTAATAGAGATGCTGAATGG - Intronic
1124611307 15:31211130-31211152 ATGTTTTTAAAAAGGGTGTATGG + Intergenic
1124848523 15:33313641-33313663 ATGCTTTTAAAGGTGTTGTCTGG - Intronic
1125699811 15:41672164-41672186 TTGTTTTTCGAGATAGTGTATGG + Intronic
1126306042 15:47258984-47259006 ATTTTTGTAGAGTTTTTGTAGGG + Intronic
1126330549 15:47526369-47526391 ATATTTTTAGAGATGCTGTTCGG - Intronic
1127934472 15:63623620-63623642 ATGTTTTTATAAATGTAGCAAGG - Intronic
1128872536 15:71173122-71173144 ATCTTTTTACAGATATTTTAGGG - Intronic
1128989594 15:72248299-72248321 CTGTTGTTAGAGATGTTTTTAGG + Intronic
1130285519 15:82551264-82551286 ATTTTTTTAGAGAAGCTTTAAGG + Intronic
1130538963 15:84807980-84808002 ATCTTTTTAGAGATGGGGTCTGG + Intergenic
1130604407 15:85302308-85302330 CTGTTTTTAGAGCTGTGGAAAGG - Intergenic
1132100201 15:99017576-99017598 AAGTTCTTATAGATGTTGGAAGG - Intergenic
1132973585 16:2700813-2700835 ATGTTTTTAGTGACATTTTAAGG - Intronic
1133099208 16:3469072-3469094 TTTTTTTTTGAGATGTTGTCTGG - Intronic
1133841719 16:9416075-9416097 ATATTTTTAGAGCTTTTGTCTGG - Intergenic
1135794819 16:25431743-25431765 ATGTTTTTATAGACGCTGAAAGG + Intergenic
1138471211 16:57238370-57238392 ATGTATTTTAAGATGTGGTATGG - Intronic
1140283560 16:73578324-73578346 ATGTCTTTAGAGATCGTATATGG + Intergenic
1141023256 16:80518405-80518427 ATGGTTTTACAGATGTTAAATGG + Intergenic
1141181635 16:81756926-81756948 CTGTTTTTAGAAATTGTGTATGG + Intronic
1141309843 16:82903043-82903065 ATCTTTATAGAGTTGTTGTAAGG - Intronic
1143575264 17:7788766-7788788 TTGTTTTTAAAGATGTTGCTAGG + Intronic
1144311222 17:14015977-14015999 ATGTTTTTAGAGTTGCAGGAAGG - Intergenic
1145211734 17:21018414-21018436 AGGTTTTTAAAAATGTTCTAGGG + Intronic
1146241606 17:31233943-31233965 ATGATGTTAGAGATGAGGTAGGG - Intronic
1150376872 17:64688733-64688755 TTGTTTTTAGAGATGGAGTTTGG - Intergenic
1153133734 18:1888287-1888309 TTGTTTTTAGAGATGTTTCTAGG + Intergenic
1154027302 18:10720633-10720655 ATCTTTTTAGAGATGTTGCTCGG + Intronic
1156602607 18:38627184-38627206 AAGTTTTCAGAGATGATGAAGGG + Intergenic
1156661116 18:39347762-39347784 GTGTTTTCTGTGATGTTGTAAGG - Intergenic
1157014347 18:43692655-43692677 TTGTTTTTTGAGATGTTTGAGGG + Intergenic
1158237901 18:55339885-55339907 ATATTTGTACAGATGTTTTAAGG - Intronic
1158711975 18:59845739-59845761 ATGTCTATAGAGACGATGTAAGG + Intergenic
1159123578 18:64197643-64197665 ATTTCTTTAAAAATGTTGTAAGG + Intergenic
1163185469 19:15636061-15636083 GTGTGTTTAGAAATGTTGTCTGG + Intronic
1163684927 19:18706643-18706665 AGGTTTTTTGAGATTCTGTATGG + Intronic
1166202410 19:41246730-41246752 ATTTTTTTAGAGATGGGGTCTGG + Intronic
1167400825 19:49267607-49267629 AGGTTTTTGGAGAGGCTGTAGGG + Intergenic
1167794282 19:51699184-51699206 ATTTGTTTAGAGATGGTGTCTGG + Intergenic
926822176 2:16864306-16864328 ATGTTTTCAGAGTTGTTTTGAGG - Intergenic
927068606 2:19500462-19500484 ATATTTTTAAAGATGTTATATGG - Intergenic
927072420 2:19544700-19544722 ATGTTTTTAAAAAATTTGTATGG + Intergenic
928164478 2:28959842-28959864 ATGTTCTGAAAGATGTTGTTAGG + Intronic
929036124 2:37693748-37693770 ATGTTTTCAAAGATACTGTAAGG + Intronic
930041551 2:47129056-47129078 ATGTGTCTAGAAATGTTGTCTGG + Intronic
930629066 2:53732259-53732281 ATTTTTTTAAAGCTGTTGTGGGG - Intronic
930705167 2:54497912-54497934 ATGTTTGTAGAGATGGTCTCCGG - Intronic
931333625 2:61316571-61316593 ATTTTTTTTGAGATGGTGTCTGG - Intronic
932746649 2:74339223-74339245 ATTTTTTTAGAAATATTGTTAGG + Intronic
932942302 2:76181674-76181696 ATTAATTTAGAGATGCTGTATGG + Intergenic
933641250 2:84762601-84762623 ATCTTTTTATAGATATTGTTTGG - Intronic
934626580 2:95862276-95862298 ATCCTTTGAGAGTTGTTGTATGG - Intronic
935225660 2:101050131-101050153 ATGCTTTTAGAAATATAGTAAGG - Intronic
935902698 2:107809633-107809655 ATCTTTTTTGAGAAGTTTTATGG - Intergenic
935928268 2:108093795-108093817 ATGTGTCTAGAAATGTTGTCTGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936973284 2:118195120-118195142 ATTTTTTTAGAATAGTTGTAGGG - Intergenic
937722295 2:125115972-125115994 ATCTTTTTAGAGTTGTTTTGTGG - Intergenic
937793721 2:125991944-125991966 ATGTTTTAAGACTTGTTTTATGG + Intergenic
938411847 2:131071509-131071531 ATGTTTTTAGAGATAATTTTTGG - Intronic
939173089 2:138718513-138718535 ATGTTTTTGGAGAGCTTGTGAGG - Intronic
939204548 2:139083607-139083629 ATGTTTTTAAATATATTATAGGG + Intergenic
939385934 2:141498335-141498357 AGGATTTTAAAGATGTTGTCTGG - Intronic
939505112 2:143036069-143036091 ATTTTTTTAGAGATGAGGTCTGG + Intronic
939745856 2:145966474-145966496 TTATTTTTAGAGCTGTTTTAGGG + Intergenic
940774782 2:157875186-157875208 ATGTGGTTACAGATGTTGCACGG - Intronic
941227635 2:162868411-162868433 GTGTGTTTAGAAATGTTGTCTGG - Intergenic
941341133 2:164305198-164305220 ATGATTTTAAATATGTTGAATGG - Intergenic
941434953 2:165458504-165458526 ATGTTTTTAGGCTTGTTATAAGG + Intergenic
941927702 2:170912886-170912908 ATGTCTACAGAGATGTTGTCAGG - Intergenic
942294883 2:174507675-174507697 GTGTGTTTAGAAATGTTGTCTGG - Intergenic
942719986 2:178940590-178940612 ATGTTTTTAAAGATATTGGGTGG + Intronic
942748309 2:179261491-179261513 ATGTTTTAAATGATGCTGTAAGG - Intronic
943056397 2:182986927-182986949 AGATTTTTAGAGAGGTTGTCAGG - Intronic
943488795 2:188522796-188522818 AAGTTGTGAGAGATGCTGTAAGG + Exonic
943634218 2:190287360-190287382 ATGTTCTTAGTTATGTTATATGG - Intronic
944286986 2:197962140-197962162 TTGTGTTTAGAGATGTTTAAAGG - Intronic
944725438 2:202466773-202466795 GTGTTTGTAGAGATGTGGTATGG + Intronic
945508819 2:210674811-210674833 TTGTCTTTTAAGATGTTGTAAGG + Intronic
946465740 2:219910298-219910320 AGGTTTTTGGGGATGTTGAATGG - Intergenic
947089215 2:226491970-226491992 TTGTTTTTAGAGAAGTAGGAAGG - Intergenic
947202833 2:227630149-227630171 ACCTTATTTGAGATGTTGTATGG + Intronic
947647631 2:231755612-231755634 TTTTTTTTAGAGATCTTGTGTGG - Intronic
948471072 2:238179722-238179744 ATGTTTTTAGCAATGTTTTATGG - Intronic
1168836361 20:880416-880438 ATATTTTTAAACATTTTGTAGGG - Intronic
1169538382 20:6572166-6572188 ATAGTTTTACAGATGTTGAAAGG - Intergenic
1170155773 20:13267978-13268000 ATGTTGTTGGAGAAGTTTTAGGG + Intronic
1177313969 21:19432421-19432443 ATCTTTTTAGAAATTTTGTGGGG - Intergenic
1177577905 21:22982608-22982630 ATGTGTCTAGAAATGTTGTCTGG - Intergenic
1177697250 21:24589468-24589490 TTGTTTTTAGTGATGGTGTTGGG + Intergenic
1178205933 21:30465121-30465143 ATGTTTTCAGAGTTTATGTAAGG + Intergenic
1178591271 21:33912999-33913021 ATGTTCTTAGTGGTGCTGTATGG + Intronic
1178635731 21:34300941-34300963 ATGTTTTGATAGATGTTATGAGG - Intergenic
1180865414 22:19116018-19116040 AGCTTTATAGAGATGTTGTGAGG - Intronic
1182893383 22:33838218-33838240 ATGTTACTAGAGATTGTGTAGGG - Intronic
949093534 3:58554-58576 AACCTTATAGAGATGTTGTAAGG + Intergenic
949353467 3:3151193-3151215 ATGTTTTTAGAAATGTTTTTAGG - Intronic
951398965 3:22206526-22206548 ATGTTTTAAGACTTGTTTTATGG - Intronic
951446782 3:22791353-22791375 ATGTTTATAGAGATATTATTTGG + Intergenic
952344787 3:32473279-32473301 ATGTTTATAGGGAAGTTGGAGGG - Intronic
952406520 3:33009658-33009680 ATGTATTTAGACTTGTTTTATGG - Intronic
954192297 3:48972324-48972346 ATTTTTTTAAATTTGTTGTAGGG + Intronic
954872591 3:53778988-53779010 ATGTTTTTAAAGCTGTTGTGAGG - Intronic
955031480 3:55225676-55225698 AGGGTTTTAGAGATGAGGTAAGG + Intergenic
955577886 3:60386426-60386448 ATGTTTTTATAGATATTGTGAGG - Intronic
955588232 3:60505470-60505492 ATGTTTTAAAAGAAGTTTTAGGG - Intronic
956000631 3:64726246-64726268 AGGTTATTAGTGATGTTGTTTGG + Intergenic
957528294 3:81406232-81406254 ATGTTTTAAGAGATTCTGAAAGG + Intergenic
957590342 3:82189042-82189064 ATGTTTTTAAAAATTTTGCAAGG + Intergenic
958089800 3:88862059-88862081 ATGTTGAATGAGATGTTGTAGGG + Intergenic
958876642 3:99624540-99624562 ATGTGTCTAGAAATGTTGTCTGG - Intergenic
959191133 3:103112937-103112959 ATGTGTCTAGAAATGTTGTCTGG - Intergenic
959679236 3:109073734-109073756 AAGTCTTCAGAGATTTTGTAAGG - Intronic
961407956 3:126696099-126696121 ATGTTTTTGAAGCTATTGTAAGG + Intergenic
962010938 3:131390306-131390328 TTGTTTTTTTAGATGTAGTAGGG - Intergenic
962767545 3:138579586-138579608 ATGTGTCTAGAAATGTTGTTTGG - Intronic
963097763 3:141563614-141563636 ACTTTTTTAGGGCTGTTGTAGGG + Intronic
963367722 3:144360217-144360239 ATGTTTTTAGAGTTCTGGTCTGG + Intergenic
963381224 3:144533051-144533073 AAACTTTTAGGGATGTTGTAAGG - Intergenic
964863573 3:161229268-161229290 CTGTTTTTAGAATGGTTGTAAGG + Intronic
966125197 3:176568280-176568302 AAGTTTAAAGAGATGTTGCAGGG - Intergenic
966606769 3:181828817-181828839 ATGTTTTTAGAAATGGGGTCTGG + Intergenic
967074912 3:185993325-185993347 ATGGCTTGAGAGATGTTGTGGGG - Intergenic
967489840 3:190077748-190077770 ATGTTTTTAGACATGTATTTAGG + Intronic
967558642 3:190892226-190892248 ATGTTTTTCAAAATGTTCTAGGG - Intronic
971189211 4:24411362-24411384 ATAATTTTAGAGATGTTTTAGGG + Intergenic
971772230 4:30911365-30911387 ATTTATTTACAGATGTTCTATGG + Intronic
972019827 4:34298299-34298321 ATATTGTTAGAGATGATCTAGGG - Intergenic
972489199 4:39571017-39571039 ATATTTTGAGAGATGCTTTAAGG - Intronic
972847975 4:43012647-43012669 ATGTTTATAGGGTTGTTGTAAGG - Intronic
972952892 4:44350600-44350622 AATTTTTTAGTGATGTTCTAAGG + Intronic
973043512 4:45504852-45504874 ATGTCTTTAGACATACTGTATGG - Intergenic
973122979 4:46545767-46545789 ATGTTTACAAAGATGCTGTATGG + Intergenic
973889818 4:55357625-55357647 ATAGTTTAAGAGATGTTGTGTGG + Intronic
974709176 4:65566305-65566327 ATGTGTATAGATATTTTGTAGGG + Intronic
975678192 4:76848934-76848956 ATATTTTTAGAAATGTTATGAGG + Intergenic
976010739 4:80485970-80485992 ATTTTTTTAGAGTTGTGGTTTGG + Intronic
977396798 4:96481113-96481135 ATGTTTTAAGACTTGTTTTATGG + Intergenic
977857348 4:101909738-101909760 ATATTTTTATATATGTTGTTGGG - Intronic
979540473 4:121875515-121875537 CTCTTTTTAAAGATGTTTTAGGG + Intergenic
980543169 4:134221285-134221307 TTGTTTTTATAGATATTTTAAGG - Intergenic
981625103 4:146746681-146746703 GTGTTTAGAGAAATGTTGTAGGG + Intronic
982855887 4:160382369-160382391 ATATTTTAAGAGATGTTATTAGG - Intergenic
984383220 4:179021762-179021784 ATGTTTTGAGAAATATTTTAAGG + Intergenic
985186872 4:187327065-187327087 ATGTTTGTAGAGACAATGTAGGG - Intergenic
985258666 4:188094077-188094099 TTGTTTTTTGAGATGCTGTCTGG - Intronic
987877662 5:23699889-23699911 ATACTTTTAGAAATGTTGAAAGG + Intergenic
989601071 5:43201111-43201133 TTTTTTTTTGAGATGTTGTCTGG - Intronic
990532174 5:56684978-56685000 ATGTGTTTAGAGATTCTGTAAGG + Intergenic
990761711 5:59137271-59137293 ATGTTTTTGGAGTTTATGTAGGG + Intronic
990957996 5:61363083-61363105 ATGTTTTTAGAGATGTTGTAGGG + Intronic
991153089 5:63395448-63395470 ATGTTGTTAGAGAAGTAGTTTGG + Intergenic
991180632 5:63747041-63747063 ATGTGTCTAGAAATGTTGTCTGG + Intergenic
992142600 5:73814164-73814186 TTGATTTTATAGATGTTATAAGG + Intronic
992142674 5:73815060-73815082 TTGATTTTATAGATGTTATAAGG + Intronic
992581389 5:78181740-78181762 ATGTTGTTATAGATGTTTAAAGG - Intronic
993257047 5:85604981-85605003 ATGTGTCTAGAAATGTTGTCTGG - Intergenic
993625983 5:90225108-90225130 ATGGTTTGAGAGATGCTGGAGGG - Intergenic
994422524 5:99539168-99539190 TTGTTTGTAGAGATGTGGTGTGG + Intergenic
994459849 5:100058335-100058357 TTGTTTGTAGAGATGTGGTGTGG - Intergenic
994955660 5:106528008-106528030 ATGTTTTTGGAAATATTTTATGG + Intergenic
995197851 5:109393620-109393642 ATTTTTTTAGAGATGGGGTCTGG - Intronic
995371816 5:111427219-111427241 GTGTGTTTAGAAATGTTGTCTGG - Intronic
996078597 5:119228654-119228676 ATTTTTTTTGAGATATTGCAAGG + Intronic
996161592 5:120173573-120173595 ATGTGTCTAGAAATGTTGTCTGG - Intergenic
996611988 5:125393293-125393315 ATGATTTTAGAGGGGTGGTATGG + Intergenic
996665477 5:126055010-126055032 ATGATTTAATAGAGGTTGTAAGG + Intergenic
997909890 5:137861395-137861417 TTGTTTTTTGAGATGTAGTCTGG + Intergenic
999427874 5:151503365-151503387 ATTTTTTTAGAGCAGTTTTATGG - Intergenic
999735940 5:154513030-154513052 ATCTTTCTAGAGATATTGTGAGG + Intergenic
1000808498 5:165829282-165829304 ATATTTTTAGAGCTGCTTTAAGG + Intergenic
1001394585 5:171407454-171407476 ATGTTCCTAGAGAGGTTGTCAGG + Intronic
1001861980 5:175064105-175064127 ATTTTTTGAGAAATGTTATATGG + Intergenic
1001914010 5:175544197-175544219 CTGTTCTTAGGGAAGTTGTATGG + Intergenic
1002556261 5:180043810-180043832 ATGTTTTCAGAGACCTTTTATGG - Intronic
1003583671 6:7366309-7366331 ATGTTTTTATAGCTCTTGTGAGG + Intronic
1004395208 6:15241829-15241851 ATGTTTGTAGAGATGGTGTCTGG + Intergenic
1004823063 6:19389757-19389779 ATCTTGTAAAAGATGTTGTACGG + Intergenic
1005202074 6:23358628-23358650 AAGTTTCTAGAGATCTTGGAGGG + Intergenic
1005482688 6:26269648-26269670 AGGTTTTTAGGGATGTTACAAGG - Exonic
1005701215 6:28402139-28402161 TTGTTTTCTGAGATGTTCTACGG - Intergenic
1006746957 6:36349600-36349622 ATATTTTTAGAGATGTTCTCTGG - Intergenic
1007079280 6:39087253-39087275 ATGGTTGTAGTGATGTTGTTTGG + Exonic
1007433388 6:41789465-41789487 ATGTGTTTTCAGATGTTGAAAGG + Intronic
1008351968 6:50502031-50502053 ATGTTTTTATTGATTTTGTCTGG - Intergenic
1008365210 6:50670702-50670724 CTGAGTTTAGAGATGTTATAGGG - Intergenic
1008847894 6:55990645-55990667 ATGTTTTAAGATTTGTTTTATGG + Intergenic
1009529931 6:64799347-64799369 ATATTTTGAGAGATTGTGTAAGG - Intronic
1009725884 6:67535475-67535497 AGTTTTTAATAGATGTTGTATGG + Intergenic
1010253272 6:73730542-73730564 ATGTTTAAAGAGGTTTTGTAAGG - Exonic
1010278973 6:74001937-74001959 ATGGTTTAAGAAATGATGTAGGG + Intergenic
1010780469 6:79940622-79940644 CTGTTTTAGGAGATGTTATAAGG + Intronic
1010925924 6:81745952-81745974 ATGATTGTAGAGAGGTTGGAGGG + Exonic
1011206143 6:84900940-84900962 ATGTTTTTACAGATATTATCAGG + Intergenic
1011691338 6:89872228-89872250 ATGTTTTAAGAGATGGAGTCAGG + Intronic
1011864033 6:91798831-91798853 ATATTATTCTAGATGTTGTAAGG - Intergenic
1012305945 6:97657344-97657366 ATTTTTTTATAGCTGTTGCATGG - Intergenic
1013374825 6:109504184-109504206 ATGTTTTTATAGAGATTGGAGGG - Intronic
1014050291 6:116944889-116944911 ATATTAATAGAGTTGTTGTAAGG - Intergenic
1014376576 6:120682531-120682553 ATGTTTTTATAAATGGTGTAAGG - Intergenic
1014404920 6:121039523-121039545 AAGTTTTTAAAGATGGTGTCTGG + Intergenic
1014905955 6:127027609-127027631 ATTTCTTTAGTGATGTTGCAGGG - Intergenic
1015253391 6:131151052-131151074 TTGTTTTTTGAGATGTAGTCTGG + Intronic
1016001748 6:139048819-139048841 ATTTTTTTTGAGATGTAGTCTGG - Intergenic
1016286843 6:142483232-142483254 ATGTTTATAGAGAGGGTGTGAGG + Intergenic
1016370403 6:143367701-143367723 ATGATCTTAGACATCTTGTAGGG + Intergenic
1016370481 6:143368762-143368784 ATGATCTTAGACATCTTGTAGGG - Intergenic
1019096986 6:169590043-169590065 ATGTTTTTACAAAAATTGTAAGG + Intronic
1019372832 7:671970-671992 ACATTTTTAGAGATGGTGTGTGG - Intronic
1020675567 7:11180944-11180966 TTGATTTTATATATGTTGTAAGG + Intergenic
1021553150 7:21893326-21893348 ATCTTTTTTGTGATTTTGTAAGG + Intronic
1024125795 7:46293452-46293474 ATATTTTTAGAGATATTCAAAGG - Intergenic
1027645991 7:80799173-80799195 ATCTTTTTAGACATCTTGTGGGG + Intronic
1028602137 7:92613667-92613689 ATGTCTTTAGCTATGTTTTAGGG - Exonic
1028953218 7:96660053-96660075 ATGTCCTTAGATATGTTTTAGGG - Intronic
1029319042 7:99741189-99741211 ATGTTTTTTGAGATGCTGTCTGG - Intergenic
1031417785 7:121513497-121513519 ATGTTTTTCAAGAAATTGTAAGG - Intergenic
1032836399 7:135679268-135679290 ATGACTTTAGAGATGTTGGCTGG + Intronic
1033055011 7:138043515-138043537 ATGTTTTTATATATTTTGTCTGG - Intronic
1033470585 7:141644878-141644900 ATGTATATAGACATGATGTATGG - Intronic
1033478332 7:141712526-141712548 ATGTTATTTGAGATTTTGAAAGG + Intronic
1037038046 8:14192514-14192536 ATGTATTCAGAGTTATTGTATGG - Intronic
1037368297 8:18146025-18146047 AAGTTGTTAGGGATGTTGGAGGG - Intergenic
1038478078 8:27882923-27882945 ATGCCTTTAGAGAGGTTGTGAGG - Intronic
1039151125 8:34506935-34506957 ATGTTTTTAAAGATTTTTTTTGG - Intergenic
1039699684 8:39949300-39949322 ATGTTTCTTGAGATGTTGGTTGG + Intronic
1040435267 8:47384498-47384520 ATGTTTTTAAACATGGTATAAGG - Intronic
1041266766 8:56073321-56073343 ATGATTTTCCAGATGTTCTAGGG - Intronic
1041440256 8:57887536-57887558 ATGGTTTTAGAGATGTTGGCTGG + Intergenic
1042738563 8:72017056-72017078 AAGTTTTCTGTGATGTTGTATGG - Intronic
1042980660 8:74523398-74523420 ATGTTTTAAGACTTGTTTTATGG - Intergenic
1043434978 8:80229368-80229390 CTATTTTTAAAGATTTTGTAAGG - Intronic
1044081056 8:87884345-87884367 ATGATGTTAGTGATGTTGTTAGG - Intergenic
1044671174 8:94682376-94682398 TTGTTTTTTGAGATGTAGTCTGG + Intronic
1044776770 8:95697802-95697824 ATGTAATTACAGATATTGTAGGG - Intergenic
1044868517 8:96596067-96596089 ATCGTTTCAGAGATGTTATAGGG - Intronic
1045038843 8:98201394-98201416 ATTTTTTTAGAGATGGGGTCCGG + Intronic
1045706836 8:104933717-104933739 ATGTATTAAGACTTGTTGTATGG + Intronic
1046026085 8:108725764-108725786 ATGTCTTTAAACATGTTATAGGG + Intronic
1046347560 8:112953081-112953103 ATGTTATTTGACATGTTGCATGG - Intronic
1046475534 8:114737704-114737726 ATTTTTTTATATATGGTGTAAGG - Intergenic
1046484673 8:114871767-114871789 ATGTTTTCAAAGATTGTGTAGGG - Intergenic
1047285089 8:123480921-123480943 ATGTTTTAAGAGCTATTGCATGG - Intergenic
1047359020 8:124150875-124150897 ATGTTTTTTGGGATCTTGCAGGG - Intergenic
1048011160 8:130457282-130457304 ATTTTTGCAGAGATGCTGTATGG - Intergenic
1048062948 8:130939067-130939089 GAGGGTTTAGAGATGTTGTAGGG + Intronic
1048488356 8:134869235-134869257 ATGTTTCTGGAGGTGTTGTGAGG + Intergenic
1048688113 8:136927144-136927166 ATATTCTTAAAGATGTTTTAAGG - Intergenic
1050930116 9:11312123-11312145 GTGTATTTAGAAATGTTGTCTGG + Intergenic
1051445656 9:17136091-17136113 CTGTTTGTAGAGTTTTTGTAAGG + Intronic
1051465456 9:17371714-17371736 ATGTTTTAAGAGTTGTTTTATGG - Intronic
1051921743 9:22274884-22274906 ATGTGTCTAGAAATGTTGTCAGG - Intergenic
1051992053 9:23163217-23163239 ATGTATTTAGAAATGTTGTCTGG - Intergenic
1052257439 9:26474846-26474868 ATGCCTTTAAAAATGTTGTATGG - Intergenic
1053028422 9:34751802-34751824 AAGTTTTAAGAGTTGTTTTATGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054799575 9:69334025-69334047 ATTTCTTTAGAAATGCTGTAAGG - Intronic
1055624273 9:78158252-78158274 ATGTTTTTAGGTTTGTTCTAGGG + Intergenic
1057369797 9:94460521-94460543 CTATTTTTTGAGATGTTTTATGG + Exonic
1058196765 9:101986061-101986083 ATGGTTTTAGTGACATTGTAGGG + Intergenic
1058384809 9:104422683-104422705 ATGTTTTTAAAGATGATCTTTGG + Intergenic
1059525031 9:114983649-114983671 ATATTATTAGTGATGTTTTATGG - Intergenic
1059705416 9:116818770-116818792 CTGTCTATAGAGATGTTATAAGG - Intronic
1060084044 9:120680647-120680669 ATGTATCCAGAGATGTTGTCTGG + Intronic
1185862062 X:3588974-3588996 ATGTTTTTTGAGATGCAGTTGGG - Intergenic
1186326443 X:8482388-8482410 ATGTTTTTAGACATGATATCTGG + Intergenic
1186974206 X:14882648-14882670 ATATTTTTAGATATGTAATAAGG - Intronic
1187413603 X:19072781-19072803 ATGTTTTTGGAGAAGTTTTATGG + Intronic
1188326081 X:28803036-28803058 ATGTTCATTGAGATCTTGTAAGG + Intronic
1188619609 X:32203859-32203881 TTGTTATTAGAGATGATGTTAGG - Intronic
1188943771 X:36271155-36271177 ATGATTTTATAGATTTTGTAGGG + Intronic
1189052424 X:37660386-37660408 ATGTTTCTAGACATTTTGTTTGG - Intronic
1189824987 X:44908841-44908863 TTCTTTTCAGAGATGTTGGAAGG + Intronic
1190015071 X:46819733-46819755 ATGTATCTAGAAATGTTGTCTGG - Intergenic
1190091571 X:47442060-47442082 ATGTTTTGAAACATGTTTTATGG + Intergenic
1193239681 X:79153095-79153117 CTGTTTTCAGAAATGCTGTATGG + Intergenic
1193361127 X:80580253-80580275 ATGTTTTTATAAATGTTTTGTGG + Intergenic
1193420913 X:81280760-81280782 ATTTTTTTGCAGATGTTGAAGGG - Intronic
1193986849 X:88252899-88252921 CTGTGTTTAGAAATGTTGTTTGG + Intergenic
1194173007 X:90612046-90612068 ATATTTTTAGAGGCGTTGAATGG - Intergenic
1194819986 X:98493279-98493301 CTGCTTTTATAGAGGTTGTATGG + Intergenic
1194868256 X:99096297-99096319 TTGGTTTTAGAGATGTTTTCTGG + Intergenic
1195650776 X:107281688-107281710 ATGTTTTAAGAATTGTTTTATGG - Intergenic
1195834925 X:109103211-109103233 ATGTGTCTATAAATGTTGTATGG + Intergenic
1196396372 X:115266622-115266644 ATGTTTCTAAAGATGTAGAATGG - Intergenic
1197362350 X:125520889-125520911 ATGTTTTTACAGGTCTTGTATGG + Intergenic
1197492345 X:127133549-127133571 GTGTTTCTATATATGTTGTAGGG - Intergenic
1197509313 X:127351207-127351229 ATATTTTTAAAGATATGGTAAGG - Intergenic
1198201736 X:134427358-134427380 ATGATTTTCAAGCTGTTGTAAGG - Exonic
1198441849 X:136671128-136671150 ATGCTTTCAGAGTTGTTGTGAGG - Intronic
1199882747 X:151987717-151987739 ATGTCTTCAGAGCTGTTGGAAGG + Intergenic
1199985141 X:152944993-152945015 ATGTTTTTATTGTTGTTGTTTGG - Intronic
1200519232 Y:4189769-4189791 ATATTTTTAGAGGCGTTGAATGG - Intergenic
1200542495 Y:4477099-4477121 TTGTGTCTAGAGATGTTGTCTGG + Intergenic
1200790344 Y:7293843-7293865 ATTTTTTTAAAGATGTTTTGAGG - Intergenic
1201492623 Y:14558852-14558874 ATGATTTTATACATTTTGTAGGG + Intronic
1201522532 Y:14891758-14891780 AAGTTTTTAGACATATTTTAAGG + Intergenic