ID: 990963404

View in Genome Browser
Species Human (GRCh38)
Location 5:61418544-61418566
Sequence ATAGAGTAGGCCGGGCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10260
Summary {0: 1, 1: 19, 2: 197, 3: 1716, 4: 8327}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990963404_990963410 26 Left 990963404 5:61418544-61418566 CCACTGTGCCCGGCCTACTCTAT 0: 1
1: 19
2: 197
3: 1716
4: 8327
Right 990963410 5:61418593-61418615 GTGACTATCTAGATGAGTGAGGG No data
990963404_990963411 27 Left 990963404 5:61418544-61418566 CCACTGTGCCCGGCCTACTCTAT 0: 1
1: 19
2: 197
3: 1716
4: 8327
Right 990963411 5:61418594-61418616 TGACTATCTAGATGAGTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 130
990963404_990963409 25 Left 990963404 5:61418544-61418566 CCACTGTGCCCGGCCTACTCTAT 0: 1
1: 19
2: 197
3: 1716
4: 8327
Right 990963409 5:61418592-61418614 AGTGACTATCTAGATGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990963404 Original CRISPR ATAGAGTAGGCCGGGCACAG TGG (reversed) Intronic
Too many off-targets to display for this crispr