ID: 990963405

View in Genome Browser
Species Human (GRCh38)
Location 5:61418552-61418574
Sequence TAAAAATCATAGAGTAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1549
Summary {0: 1, 1: 2, 2: 30, 3: 194, 4: 1322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990963405_990963411 19 Left 990963405 5:61418552-61418574 CCCGGCCTACTCTATGATTTTTA 0: 1
1: 2
2: 30
3: 194
4: 1322
Right 990963411 5:61418594-61418616 TGACTATCTAGATGAGTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 130
990963405_990963409 17 Left 990963405 5:61418552-61418574 CCCGGCCTACTCTATGATTTTTA 0: 1
1: 2
2: 30
3: 194
4: 1322
Right 990963409 5:61418592-61418614 AGTGACTATCTAGATGAGTGAGG No data
990963405_990963410 18 Left 990963405 5:61418552-61418574 CCCGGCCTACTCTATGATTTTTA 0: 1
1: 2
2: 30
3: 194
4: 1322
Right 990963410 5:61418593-61418615 GTGACTATCTAGATGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990963405 Original CRISPR TAAAAATCATAGAGTAGGCC GGG (reversed) Intronic
900233168 1:1572750-1572772 TAACAAAGATGGAGTAGGCCGGG - Intronic
900313592 1:2046518-2046540 GGAAAATCACAGGGTAGGCCCGG + Intergenic
900656181 1:3758913-3758935 TAAAAATCACAAATTAGGCCAGG + Intronic
900892712 1:5461080-5461102 CTAGAATCATAGAGTAGGCAGGG - Intergenic
901507205 1:9692429-9692451 TAAAAATCAAAATATAGGCCGGG + Intronic
901568045 1:10135308-10135330 AAAAATTAATACAGTAGGCCTGG + Intronic
901704572 1:11063658-11063680 TAAAAAACAAACAGAAGGCCAGG + Intergenic
901907342 1:12425260-12425282 TAAAAATCAGAAAGCAGGCCGGG + Intronic
901945205 1:12696457-12696479 TAAGAAACATAGAGAAGGCCAGG - Intergenic
902407617 1:16194053-16194075 TAAAAATAAAATAGTTGGCCAGG + Intergenic
902589625 1:17464455-17464477 TAAAAATCAGAGTTTAGGCCGGG + Intergenic
902948200 1:19859286-19859308 TAAAAACCATCTAGTAGGGCTGG + Intergenic
902972881 1:20067821-20067843 TTAAAATCAGAGGGGAGGCCGGG + Intronic
903166901 1:21526433-21526455 AAAAATTAATAAAGTAGGCCGGG - Intronic
903660806 1:24977210-24977232 TAAAGTTCATATAGGAGGCCAGG + Intergenic
903678111 1:25078730-25078752 TAAAAATTCTAAAGTAGGCCAGG + Intergenic
903693468 1:25190984-25191006 TAAAAATCAAATTATAGGCCAGG - Intergenic
904064340 1:27737242-27737264 TAGAAATAAAAGAGCAGGCCGGG - Intronic
904069028 1:27778528-27778550 TAAAAATCAAAAAGTAAGCCGGG + Intronic
904291898 1:29491769-29491791 TAAAAACCACTGAATAGGCCGGG - Intergenic
904546185 1:31274613-31274635 TTAAAAGGATAGATTAGGCCAGG - Intronic
904648187 1:31984241-31984263 AAAAAATCAGACAGTAGGCCGGG + Intergenic
904689159 1:32280944-32280966 TAAAAATAAGAGACTAGGCCAGG + Intronic
905055877 1:35092954-35092976 TCAAGATCATAGAGCAGGCAAGG + Intronic
905089628 1:35418538-35418560 TAAAACTCATAAAGTCGGACTGG - Exonic
905147261 1:35896651-35896673 TAAAAGTAAGAGGGTAGGCCAGG - Intronic
905164216 1:36067412-36067434 TAAAAAAGAAAGAATAGGCCGGG + Exonic
906738673 1:48158869-48158891 TAGAAGTTATAAAGTAGGCCTGG - Intergenic
906817194 1:48891227-48891249 TAAAAATCATAGTGTGGATCAGG + Intronic
906918195 1:50034407-50034429 TAAAACTAATAGAGGAGGCTGGG - Intergenic
906982905 1:50650310-50650332 TAAAACTGAAAGAGTTGGCCGGG + Intronic
907154269 1:52318800-52318822 TAATAACGATACAGTAGGCCAGG + Intronic
907339267 1:53722835-53722857 AAAAAAAAAAAGAGTAGGCCAGG + Intronic
907899629 1:58726163-58726185 TAAAAATCCTGAAATAGGCCAGG + Intergenic
907978105 1:59453291-59453313 TTAAAATAAGAGAGTATGCCTGG - Intronic
908121132 1:60987000-60987022 TTAAATTCTTAGAGTATGCCTGG + Intronic
908138242 1:61155376-61155398 TTAAAATTCTAGAGTTGGCCGGG + Intronic
908268397 1:62400111-62400133 AAAAAATAATAAAATAGGCCGGG + Intergenic
908529143 1:65017168-65017190 GAAAAATCATTAAATAGGCCAGG + Intergenic
908740175 1:67319245-67319267 AAAAATTCATAAAGTAGGCTGGG - Intronic
909446417 1:75754089-75754111 TAAAAATGAAAAACTAGGCCAGG - Intronic
909985833 1:82159765-82159787 TAAAACTCACAGAGGTGGCCAGG + Intergenic
910406512 1:86897008-86897030 AAAAAATCAAAGAGCAGGCCGGG + Intronic
910455781 1:87395859-87395881 TAAAAATAATAGAGTTGGCCGGG - Intergenic
910474619 1:87593473-87593495 TGAAAACCAAATAGTAGGCCGGG - Intergenic
910552448 1:88491414-88491436 TAAAAATCAATGGATAGGCCAGG + Intergenic
910577986 1:88788738-88788760 TAAGAATCCTGGATTAGGCCAGG - Intronic
910579835 1:88810900-88810922 TAAGAATCATAAAGTAGGCCAGG - Intronic
910608752 1:89116307-89116329 TAAAAATGATTGAGTTGGCTGGG - Intronic
910671574 1:89778748-89778770 TAACAGTCACAGAGTCGGCCGGG + Intronic
910750663 1:90626931-90626953 TTAAAATATCAGAGTAGGCCGGG + Intergenic
910943456 1:92562232-92562254 TAAAAATATTATAATAGGCCAGG + Intronic
910978279 1:92931430-92931452 TAAAAGACATGGAGAAGGCCAGG + Intronic
911009578 1:93265205-93265227 TTAAAATCATAAAGTAGGCCGGG + Intronic
911011192 1:93282582-93282604 TAAAATACATATTGTAGGCCGGG + Intergenic
911113911 1:94223237-94223259 TAAAAAAGATAAAATAGGCCAGG - Intronic
911183717 1:94883203-94883225 TAAGAAACAAAGACTAGGCCGGG + Intronic
911382526 1:97133700-97133722 TTAAAATTATATTGTAGGCCTGG + Intronic
911529026 1:99021544-99021566 TTAAAATTATTCAGTAGGCCTGG + Intergenic
912016417 1:105042503-105042525 TAAAAGACATAGAGTGGGCAGGG + Intergenic
912524251 1:110269009-110269031 TAATAATCTCAGGGTAGGCCGGG - Intronic
912663489 1:111557251-111557273 TAAAAATCTTACAGAAGGCCAGG + Intronic
912995348 1:114527595-114527617 AAAAAATCATAGACTGGGCTTGG - Intergenic
913133283 1:115862832-115862854 TAAAAAGGACGGAGTAGGCCAGG + Intergenic
913220503 1:116656627-116656649 TAAAATTCAAAAATTAGGCCAGG + Intronic
913570702 1:120117163-120117185 TAAAAAACATAGAATTGGCCGGG - Intergenic
914291509 1:146278139-146278161 TAAAAAACATAGAATTGGCCGGG - Intergenic
914347627 1:146813655-146813677 TAAAAATCATATGCTTGGCCTGG + Intergenic
914552553 1:148728922-148728944 TAAAAAACATAGAATTGGCCGGG - Intergenic
914671853 1:149876824-149876846 TAAAAACCCAAGAGGAGGCCAGG + Intronic
914793873 1:150903421-150903443 TAAAAATCAAAGAGAACGTCTGG - Intergenic
914837330 1:151218539-151218561 TAAAAACCAAAGATGAGGCCGGG + Intronic
914891209 1:151625209-151625231 TAAAAATACTGGTGTAGGCCAGG + Intronic
914891310 1:151625966-151625988 TAAAAATAAAAGATTGGGCCGGG + Intronic
915015278 1:152727360-152727382 TAAAAACTACAGGGTAGGCCAGG + Intergenic
915365439 1:155312683-155312705 TAAAAGTGACAGAGGAGGCCGGG + Intronic
915487104 1:156229201-156229223 AAAAAACAATACAGTAGGCCAGG - Intronic
915830612 1:159126350-159126372 TAAAATTGATAGAATAGGCCGGG + Intronic
916040768 1:160959447-160959469 TAAAAATCAAAGACCAGGCCAGG + Intergenic
916228104 1:162509938-162509960 TAAAAAACAAAAACTAGGCCAGG - Intronic
916232036 1:162550071-162550093 CAAAAATCTTAGAGTCGGCCGGG - Intergenic
916597700 1:166261493-166261515 TAAGAATCAGAGACAAGGCCAGG - Intergenic
916698709 1:167267934-167267956 TAAAAAAGACACAGTAGGCCGGG - Intronic
917321812 1:173790472-173790494 TAAAAATGATAGTCTGGGCCAGG + Intergenic
917384485 1:174454844-174454866 TAAAAATCCTACAGTGGGCCGGG - Intronic
917421772 1:174871032-174871054 TAAAAATGTTATAATAGGCCGGG - Intronic
917462081 1:175240785-175240807 TAAGAATGATACAGTAGGCCAGG + Intergenic
917641929 1:176991110-176991132 TAAAAATTATAGAGCCGGCCGGG + Intronic
917863657 1:179172892-179172914 TAAAAATCATAAGTTCGGCCAGG + Intronic
917873106 1:179259513-179259535 AAGAAATCACAAAGTAGGCCGGG - Intergenic
917951714 1:180045044-180045066 TAAAAAATATTGAATAGGCCGGG + Intronic
917986380 1:180324172-180324194 CAAAAGACATAGAGTAGGCCGGG - Intronic
918213579 1:182373689-182373711 TAAAATTCATACACCAGGCCGGG + Intergenic
918293417 1:183132001-183132023 TACATATAATAAAGTAGGCCGGG + Intronic
919132326 1:193466805-193466827 TAAAATTAATAGAGGTGGCCGGG - Intergenic
919449552 1:197754389-197754411 TAAAACTGATAAAGTAGGCCAGG + Intronic
919596176 1:199565258-199565280 TAAAAACCTTAGAGTAGTCGGGG - Intergenic
919653882 1:200178957-200178979 TAAAAATCTTAGTTTTGGCCAGG - Intergenic
919875089 1:201859662-201859684 TAAAAAGAAAAAAGTAGGCCAGG + Intronic
920020255 1:202950276-202950298 TAAAAGGCAAAGAGTTGGCCGGG + Intronic
920126650 1:203698929-203698951 TAAAAATTATTAAATAGGCCAGG - Intronic
920144247 1:203844462-203844484 TAGAAATCCCAGAGCAGGCCAGG - Intronic
920344953 1:205300374-205300396 TCAAAAACATTAAGTAGGCCAGG - Intergenic
920373422 1:205493535-205493557 AAAAAATCACAGTGTTGGCCTGG + Intergenic
921201293 1:212809387-212809409 TAAAAATTAAAAACTAGGCCGGG + Intronic
921202020 1:212816181-212816203 TAAAAATGTTAGTGTAAGCCAGG + Intronic
921397342 1:214682487-214682509 TAAAAAGCAAAAACTAGGCCGGG - Intergenic
922165470 1:223112251-223112273 CAAGAATCAAAGAGAAGGCCTGG + Exonic
922599915 1:226842664-226842686 TAAAAATGGAAAAGTAGGCCGGG - Intergenic
922727663 1:227930723-227930745 TAAAAATCATAAATGAGGCCAGG + Intronic
922747723 1:228054858-228054880 TAAAAATTATATAATAGGCTGGG + Intronic
923320458 1:232827500-232827522 AAAAAATCAAAAAATAGGCCTGG - Intergenic
923581458 1:235219158-235219180 AAAAAATCATTTAGCAGGCCAGG - Intronic
923665762 1:235997127-235997149 AAAAAAGCAGAGAGGAGGCCAGG - Intronic
923728248 1:236525697-236525719 TAAAAATACTAAAATAGGCCAGG - Intronic
923806728 1:237265615-237265637 AAAAAATCCTTGAGCAGGCCAGG - Intronic
924091914 1:240510072-240510094 TAAAAAGCAAATGGTAGGCCGGG + Intronic
924351428 1:243118176-243118198 TAAAAACCATTGAATTGGCCGGG - Intergenic
924524313 1:244833315-244833337 TAAAAATTTTAAAATAGGCCAGG + Intergenic
924783690 1:247174737-247174759 TAAAAATCAAAGGATGGGCCGGG - Intergenic
1063090776 10:2864692-2864714 TAAAAAGGAGAGAGAAGGCCGGG + Intergenic
1063490862 10:6462707-6462729 TAAAAGTAATAGTATAGGCCAGG + Intronic
1063633938 10:7762958-7762980 TTAAAATCTCAGAGTAGGCCGGG + Intronic
1063652791 10:7956192-7956214 TAAAAATTAAAAAATAGGCCGGG + Intronic
1064037724 10:11928412-11928434 TAAAAAACATAAAAGAGGCCGGG + Intronic
1064178288 10:13094548-13094570 TAAAAATCTTGAAATAGGCCGGG - Intronic
1064308928 10:14194313-14194335 TAAAAAACACGGAGGAGGCCGGG + Intronic
1064332508 10:14406908-14406930 TGAAAAGCACAGAGGAGGCCAGG - Intronic
1064428096 10:15247766-15247788 TAAAAATGATATAGTAGGCTGGG - Intronic
1064590410 10:16884275-16884297 TTAAAATTAGATAGTAGGCCGGG - Intronic
1064706530 10:18078153-18078175 TAAAAATTATACTTTAGGCCAGG + Intergenic
1064832421 10:19485346-19485368 TTAAAATAATAAAGAAGGCCGGG + Intronic
1064853624 10:19739476-19739498 TATAAATAGTACAGTAGGCCAGG + Intronic
1064892415 10:20192299-20192321 TAAAACGTTTAGAGTAGGCCAGG - Intronic
1065485005 10:26228892-26228914 TAAAAATTGTTGATTAGGCCAGG + Intronic
1065556070 10:26916675-26916697 TAAAAATGACACACTAGGCCTGG - Intergenic
1065584677 10:27206318-27206340 AAAAAAACATAGAGCATGCCAGG + Intronic
1065851572 10:29794473-29794495 TAGAAACCATAAAATAGGCCAGG + Intergenic
1065902593 10:30222111-30222133 TTAAAATCAAGGTGTAGGCCAGG + Intergenic
1065914056 10:30337441-30337463 TAAAAACCACTGAGAAGGCCAGG + Intronic
1066080176 10:31922835-31922857 AAAAAATCATAGGTTAGGCAAGG + Intronic
1066125356 10:32336361-32336383 TAAAAATTAGGTAGTAGGCCGGG - Intronic
1066415979 10:35222516-35222538 TAAAAATCATTGAGTTGTACAGG - Intergenic
1067057307 10:43059670-43059692 TAAAAGTCATAAATTGGGCCAGG + Intergenic
1068207634 10:53876479-53876501 TAAAAATACAAGAGTTGGCCGGG - Intronic
1068215748 10:53979921-53979943 TTAAAATGATAAACTAGGCCAGG + Intronic
1068239291 10:54284128-54284150 TGAAAATCATTTATTAGGCCGGG - Intronic
1068342219 10:55720190-55720212 TGAAAATAATAGAGTTGGCCAGG + Intergenic
1068537664 10:58258013-58258035 TAAAACAAATAGAATAGGCCAGG + Intronic
1068660670 10:59620171-59620193 TAAAAATCATTAGGTGGGCCAGG - Intergenic
1068716526 10:60195090-60195112 TAAAAAGCATAAGGGAGGCCGGG + Intronic
1068875500 10:61991732-61991754 AAAAAATCATTGTGGAGGCCAGG + Intronic
1069123443 10:64598433-64598455 TTAAAATCTTAAAGTCGGCCGGG - Intergenic
1069231998 10:66022011-66022033 TAAAAATAAAATAATAGGCCAGG - Intronic
1069308727 10:67005979-67006001 AAAAAATCATGGAGTAGGTTGGG - Intronic
1069472212 10:68703425-68703447 TAAAAATAATAAAGTCGGCCAGG + Intergenic
1069488792 10:68843853-68843875 CAAAAATAATAAAATAGGCCGGG - Intronic
1069502423 10:68965999-68966021 AAAAAATCATAGTTTTGGCCAGG + Intronic
1069527496 10:69185793-69185815 GAAAAATGATCGAGTTGGCCGGG - Intronic
1069535731 10:69251389-69251411 CAAAACTTATAAAGTAGGCCGGG - Intronic
1069644540 10:69983739-69983761 TAAAAATAATACAATCGGCCAGG + Intergenic
1069673512 10:70231269-70231291 TAAAAATCAAAGTGGAGGCCAGG + Intronic
1069976481 10:72217177-72217199 TTAAAATGAAAGTGTAGGCCGGG + Intronic
1070090096 10:73276241-73276263 TAAAAAGCAAAGATTTGGCCAGG - Intronic
1070252546 10:74785614-74785636 TAAAAATAATAGCACAGGCCGGG + Intergenic
1070295250 10:75155186-75155208 TAAAAATCTTGGAATAGGCTGGG - Intronic
1070309039 10:75259912-75259934 TAAAACTCTTAGAAGAGGCCGGG - Intergenic
1070391487 10:75974559-75974581 TGAAACTCTTAGAATAGGCCTGG - Intronic
1070611185 10:77933885-77933907 TAAAATACGGAGAGTAGGCCGGG + Intergenic
1070958715 10:80483611-80483633 TAAAAAGTGTAAAGTAGGCCGGG + Intronic
1071530750 10:86389051-86389073 TAAAAAGCATAGACTGGGCCGGG - Intergenic
1071540220 10:86476068-86476090 TAAAAAGCACTGACTAGGCCGGG + Intronic
1071583173 10:86792358-86792380 TAAAGATCTGACAGTAGGCCAGG - Intronic
1071592169 10:86884708-86884730 TAAAAATCATATGCTTGGCCAGG - Intronic
1071704605 10:87983407-87983429 TAAAAATAAGTGAGTGGGCCGGG - Intergenic
1071866765 10:89742994-89743016 TAAAAAGCATAGAGAAGGCCGGG - Intronic
1072202222 10:93170801-93170823 TAAAAACCAAAGACAAGGCCGGG + Intergenic
1072313507 10:94179799-94179821 TAAAGATGAGAGATTAGGCCGGG - Intronic
1072323405 10:94272873-94272895 AAAAAATCAAAGCTTAGGCCAGG - Intronic
1072626197 10:97113841-97113863 TAAAAATCTTAAAAGAGGCCGGG - Intronic
1072653682 10:97315630-97315652 TAAAACTCATTGAGTGGGCTGGG - Intergenic
1072686712 10:97542029-97542051 TAAGAATCAGAGAGGAGGCCGGG - Intronic
1072698317 10:97620825-97620847 TAAAAAACAAAAAATAGGCCGGG + Intronic
1072810086 10:98454731-98454753 AGAAAATCATAGTGGAGGCCAGG + Intergenic
1072852093 10:98906608-98906630 TAAAAATGCTAGAATAGGCTGGG + Intronic
1072865413 10:99055005-99055027 AAAATATTGTAGAGTAGGCCGGG - Intronic
1073220228 10:101865782-101865804 TGAAAATATTACAGTAGGCCAGG - Intronic
1073411007 10:103341737-103341759 TGAAAATTAAAGAGTTGGCCGGG - Intronic
1073777821 10:106806072-106806094 AAGAAATCATGGAGTAGGCCGGG + Intronic
1075050583 10:119180388-119180410 TCAAAATCGTACTGTAGGCCGGG + Intergenic
1075165040 10:120060236-120060258 TAAAAATTATTGACTAAGCCTGG + Intergenic
1075176749 10:120171336-120171358 TAAAAATATTAGTGTTGGCCAGG + Intergenic
1075571913 10:123552383-123552405 TAAAAATCTGAGAGTCAGCCGGG - Intergenic
1075768332 10:124912640-124912662 CAAAAGTCAGAGAGTGGGCCAGG - Intergenic
1076142291 10:128089186-128089208 TAAAAATACTTGAGAAGGCCAGG + Intergenic
1076913998 10:133410350-133410372 TAAAAGACATAGAGTAGGCCAGG - Intronic
1077046138 11:546271-546293 TCAAAAAAATAAAGTAGGCCAGG + Intronic
1077135691 11:997183-997205 TTAACATCATAGATGAGGCCAGG + Intronic
1077644984 11:3915690-3915712 TAAAAATTAAAAACTAGGCCGGG - Intronic
1077765593 11:5156622-5156644 TAAAAAATATTCAGTAGGCCGGG - Intronic
1077815837 11:5684650-5684672 TAAAAAGTATAGAGTAGGGAGGG + Intronic
1077960308 11:7069920-7069942 TAAAAAGCAAGGAATAGGCCAGG - Intronic
1078774275 11:14380211-14380233 AAAAAATCATATTGTAGGCTGGG + Intergenic
1078981879 11:16544926-16544948 TAAAACTTATAGAGAGGGCCAGG + Intronic
1079055039 11:17198403-17198425 TAAAAATCACACAGTTGGCCTGG - Intronic
1079070162 11:17337928-17337950 TAAAAATCAAGGAAAAGGCCAGG - Intronic
1079667138 11:23120242-23120264 TAAAAATCATAGGCTGGGCGCGG - Intergenic
1079676483 11:23233194-23233216 TAAAAATAAAAGAGTAACCCTGG - Intergenic
1079677643 11:23250668-23250690 TAAAAATCACAGCAAAGGCCGGG - Intergenic
1079820209 11:25117340-25117362 TAAAAATGAATGAGCAGGCCTGG + Intergenic
1080349956 11:31372116-31372138 TAAAAAAAAAAGAGTCGGCCGGG - Intronic
1080523994 11:33095193-33095215 TAAAAATAAATGAATAGGCCGGG - Intronic
1080990599 11:37529593-37529615 GAAAAATCATTTTGTAGGCCAGG - Intergenic
1081096088 11:38937148-38937170 TAAAAAACAAAGATTGGGCCAGG - Intergenic
1081248829 11:40803766-40803788 TAAAAATTAAAAATTAGGCCGGG - Intronic
1081518873 11:43862054-43862076 TAAAAATCAGAGGTTAGGCTGGG - Intergenic
1081835903 11:46154133-46154155 TAAAAATGATAAAATAGGCTGGG + Intergenic
1082014458 11:47474190-47474212 AGAAAATCATTGAGTAGGCTGGG - Intronic
1082018148 11:47508251-47508273 TAAAAGTCAAAGAAAAGGCCAGG + Intronic
1082034382 11:47632993-47633015 TAAAACTCAGTGACTAGGCCGGG - Intronic
1082218340 11:49601775-49601797 TAAAAATAAAAGAATAGGCTGGG - Intergenic
1082714320 11:56593388-56593410 AAAAAATAATAAAATAGGCCAGG - Intergenic
1083145527 11:60755526-60755548 CAAGAATCAGATAGTAGGCCGGG - Intergenic
1083324077 11:61864688-61864710 TAAAAATAAAAAATTAGGCCAGG - Intronic
1083345192 11:61984597-61984619 TAAAAATCAAAAAAGAGGCCAGG - Intergenic
1083367367 11:62149624-62149646 TTAAAATTAAAAAGTAGGCCTGG + Intronic
1083466555 11:62850751-62850773 TAAAAAGCAGAGATTTGGCCAGG + Intergenic
1083805804 11:65073238-65073260 TAAAAATGAGATAGTCGGCCGGG - Intronic
1083971364 11:66077995-66078017 TAAAAACCTTACAGTTGGCCAGG - Intronic
1084066995 11:66710377-66710399 TAAAAATCATGCTGTGGGCCGGG - Intronic
1084427697 11:69094583-69094605 TAAAAATCAAAGAGGAGGCGTGG + Intergenic
1084571290 11:69961485-69961507 TAAAAATCCCAGGGTAGGCCTGG + Intergenic
1084629689 11:70339716-70339738 TAAAAATAAATGAGTAGGCCAGG + Intronic
1084862684 11:72030992-72031014 TAAAAAATATAAAGTAGGCCAGG + Intronic
1085087380 11:73679019-73679041 TAAAAAACATAAAACAGGCCGGG - Intronic
1085120118 11:73962086-73962108 TAAAAATAATAAATTAGACCTGG - Intronic
1085342034 11:75738467-75738489 TAAAAACCACAAGGTAGGCCAGG + Intergenic
1085437618 11:76522654-76522676 TAAAAAAGACAAAGTAGGCCAGG - Intronic
1085605541 11:77894573-77894595 TAAAAATCAAAGAGTATCACAGG + Intronic
1086233500 11:84598628-84598650 TTAAAATCATATAACAGGCCAGG + Intronic
1086326748 11:85709132-85709154 TAAAAATCACAGAGAAAGGCCGG - Intronic
1086507470 11:87520876-87520898 TAAAAACCATAGGCTAGGCCGGG - Intergenic
1086631234 11:89022345-89022367 TAAAAATAAAAGAATAGGCTGGG + Intronic
1086657346 11:89375601-89375623 TAAAAATCACAGTGTGGGCTGGG - Intronic
1086801059 11:91175816-91175838 TAATAATCATAAATTAGGCCGGG - Intergenic
1086910829 11:92469808-92469830 TAATAATCACAAATTAGGCCAGG - Intronic
1086959944 11:92971254-92971276 TAAAAATCCTAGAGTTGGCCGGG - Intronic
1087456200 11:98389492-98389514 AAAAATTCATCCAGTAGGCCGGG - Intergenic
1087662814 11:101007676-101007698 TAAAAATTCTAGATTAAGCCTGG + Intergenic
1087748422 11:101977335-101977357 TAAAAAGCAAAGAAAAGGCCGGG + Intronic
1087860437 11:103146891-103146913 TAAAAATAGCAGAATAGGCCAGG - Intronic
1088281086 11:108135412-108135434 TCAAAATGATAGCGTAGGCTGGG + Intronic
1088498105 11:110453039-110453061 TAAAACTCATAGAACTGGCCAGG + Intronic
1088662296 11:112059686-112059708 TAAAAATCAAAGAGAGGTCCGGG - Intronic
1089227137 11:116934676-116934698 TAATAATTATAGATTAGGCCAGG + Intronic
1089245334 11:117115208-117115230 TAAAAATGCTACAATAGGCCGGG - Intergenic
1090448541 11:126785580-126785602 TAAAAAGCCTATAGAAGGCCAGG + Intronic
1090499836 11:127250688-127250710 TAAAAATCATAGCGAAGGCCGGG + Intergenic
1090581397 11:128164002-128164024 TAAAATTATTAGAGCAGGCCAGG - Intergenic
1091092764 11:132788172-132788194 TTAAAATCATCAAGTGGGCCAGG - Intronic
1092190224 12:6514008-6514030 AAAATATGATAGAGTTGGCCGGG - Intronic
1092328158 12:7556261-7556283 TAAAAATCAGATATTAGGGCTGG + Intergenic
1092385154 12:8031422-8031444 TATAAAGTAGAGAGTAGGCCGGG + Intergenic
1092391658 12:8085311-8085333 TAAAAAGCTTGAAGTAGGCCGGG - Intronic
1092651267 12:10637634-10637656 TAAAAATCCTAGACTCGGCCAGG - Intronic
1093061371 12:14610150-14610172 TAAAAGACATAGAGTAGGGCAGG - Intergenic
1093738424 12:22651979-22652001 TAAAAAGCATAGAATTGGCCAGG - Intronic
1093786838 12:23201724-23201746 AAAAAATAATAGAGTGGGTCAGG + Intergenic
1093969246 12:25359751-25359773 TTAAAAAATTAGAGTAGGCCAGG - Intergenic
1094091511 12:26655317-26655339 TAAAAATGGCAGAGAAGGCCGGG + Intronic
1094164040 12:27423622-27423644 AAAAAAGTGTAGAGTAGGCCGGG - Intronic
1094279318 12:28718000-28718022 AGAAAATCATACAGAAGGCCGGG + Intergenic
1094577743 12:31703030-31703052 TAAATAACATAATGTAGGCCAGG - Intronic
1094711543 12:32968109-32968131 TAAAAATCTAACAGTAGGCCAGG - Intergenic
1095277314 12:40301881-40301903 AACAATTCATAAAGTAGGCCAGG + Intronic
1095484090 12:42666162-42666184 CAAAACTCATAGAATAGGCCAGG - Intergenic
1095739326 12:45590071-45590093 TAAAAATAAAATATTAGGCCAGG + Intergenic
1095808365 12:46345667-46345689 TTAAAATCTTAAAATAGGCCGGG + Intergenic
1096061875 12:48708249-48708271 TAAAAAGTTTAGAGTAGGCCGGG + Intronic
1096081381 12:48835275-48835297 TAAAAATCAGAGATTCAGCCAGG + Intronic
1096089912 12:48892125-48892147 TAAAAATTCTAAAGTATGCCGGG - Intergenic
1096133105 12:49176497-49176519 AAAACAGCATACAGTAGGCCAGG + Intergenic
1096189484 12:49606055-49606077 TAAAAAGCAACAAGTAGGCCGGG - Intronic
1096306648 12:50483762-50483784 TAAAAATAAAAAAATAGGCCTGG - Intergenic
1096312331 12:50532217-50532239 TAAAAATAAGAGTGTTGGCCGGG + Intronic
1096630563 12:52924151-52924173 TTAAAATCATACATTAGGCCAGG + Intronic
1096646030 12:53036405-53036427 TAAAAATAAAAAACTAGGCCGGG - Intronic
1096705558 12:53419571-53419593 TGAAAATAAAAGAGGAGGCCGGG - Intergenic
1097012142 12:55960840-55960862 TTAAAAACACAGAGAAGGCCGGG - Intronic
1097025058 12:56048991-56049013 TAGAAAAGATACAGTAGGCCAGG + Intergenic
1097541159 12:60945561-60945583 TAAAAAAGAGAGAGTGGGCCAGG + Intergenic
1098515817 12:71375801-71375823 TAGAAATTATAGAATAGGCCAGG + Intronic
1099356028 12:81636558-81636580 TTAATATCAGAGAGTTGGCCGGG - Intronic
1099514316 12:83577869-83577891 TAAATATCACAGAAGAGGCCTGG - Intergenic
1099521047 12:83662925-83662947 TTAAAACCTTAGAGTAGGTCAGG + Intergenic
1099796248 12:87403619-87403641 TAAAAATAACATGGTAGGCCAGG - Intergenic
1099977314 12:89559338-89559360 CAAAAATCACAAAGCAGGCCAGG - Intergenic
1100495379 12:95119933-95119955 TAAAAATAAAAAAATAGGCCAGG + Intronic
1100628539 12:96362512-96362534 TAAAAATCAAAGTGGAGGCTGGG - Intronic
1100629408 12:96372542-96372564 TAAAGATGATAGAGTATGCTTGG - Intronic
1100824191 12:98459376-98459398 TATAAATAATAAAATAGGCCGGG - Intergenic
1101017024 12:100512344-100512366 TAAAAATGACAATGTAGGCCGGG + Intronic
1101091499 12:101291257-101291279 TAAAAAACTTAGAATGGGCCGGG + Intronic
1101379110 12:104198684-104198706 GAAAAATCAAAAAGAAGGCCAGG + Intergenic
1101596838 12:106174557-106174579 TAAAAACCAAGGAGTAGGCCGGG - Intergenic
1102041068 12:109801018-109801040 TAAAAATCCTAGAGGAGGCCAGG + Intronic
1102133461 12:110552567-110552589 TATAAAACATACAGTGGGCCGGG + Intronic
1102166159 12:110808380-110808402 TAAAAATAAAAAAATAGGCCAGG + Intergenic
1102170631 12:110839801-110839823 TAAAAATCTTTGACTTGGCCGGG + Intergenic
1102179714 12:110903170-110903192 TAAAAAACAAAAATTAGGCCAGG - Intronic
1102229503 12:111252764-111252786 TGAAGATCATCTAGTAGGCCAGG + Intronic
1102275191 12:111576662-111576684 TAATAAACACAGGGTAGGCCAGG + Intronic
1102279898 12:111610655-111610677 TAAAAATTAAAAAATAGGCCAGG + Intergenic
1102325834 12:111982988-111983010 TAAAAATAATAGTTTAGGCTGGG + Intronic
1102342980 12:112138253-112138275 TAAAAATAAAAAGGTAGGCCAGG + Intronic
1102462836 12:113110622-113110644 TAAAAATAAGAGATCAGGCCGGG + Intronic
1102835910 12:116059848-116059870 TAAAAAACATAAAGGAGGCACGG + Intronic
1102864365 12:116362233-116362255 TTAAAAACATAGTGCAGGCCGGG + Intergenic
1102883099 12:116501145-116501167 TAAAAATCATGGTGTATGCCAGG + Intergenic
1103111655 12:118285336-118285358 TAAAATAAATAGATTAGGCCTGG - Intronic
1103292051 12:119854653-119854675 TTAAAATAATAAAGTGGGCCGGG + Intronic
1103320326 12:120088957-120088979 TAAAAACCATAAAGTAGGCCGGG - Intronic
1103344465 12:120240189-120240211 TAACAATCATAAAGCAGTCCTGG + Intronic
1103579844 12:121906507-121906529 TAAAAATAAGAAATTAGGCCTGG + Intronic
1103599389 12:122044525-122044547 TAAAAATCAAACAATTGGCCAGG + Intronic
1103669162 12:122597540-122597562 TAAAAATCAGATATTAGGCCGGG - Intronic
1103696159 12:122817353-122817375 TAAAAATAAAAAAATAGGCCAGG - Intronic
1103800686 12:123534843-123534865 TAAAAATCTAAAAGTTGGCCGGG + Intergenic
1104015950 12:124962358-124962380 TAAAAATCTAAGAATTGGCCGGG + Intronic
1104399366 12:128463074-128463096 TAAAAGTCATAGCTTTGGCCAGG - Intronic
1104430144 12:128709637-128709659 TAAAAAACATTAAGTTGGCCGGG - Intergenic
1104569920 12:129916165-129916187 TAAAAAATGTAGACTAGGCCGGG + Intergenic
1104681609 12:130755795-130755817 TAAAAATCAGACAGCAGGCCAGG + Intergenic
1104988202 12:132609398-132609420 TAAAAATCATTAAGACGGCCCGG + Intronic
1105370685 13:19799242-19799264 TAAAAATCATTGATGGGGCCAGG - Intergenic
1105509162 13:21037106-21037128 TAAAAATCATATTTTAGGACCGG + Intronic
1105554033 13:21428513-21428535 TAAAAAACATAGTTTGGGCCTGG - Intronic
1105679288 13:22709057-22709079 TAGAAATCACAGAGTGTGCCTGG - Intergenic
1105742856 13:23346437-23346459 TAAAAAGCATAGAGGGGGCCAGG - Intronic
1105832933 13:24181817-24181839 TAAAAAGTATAGTATAGGCCGGG + Intronic
1105878230 13:24579158-24579180 TAAAAGTCACAGAGTGGGCTGGG - Intergenic
1105921972 13:24971490-24971512 TAAAAGTCACAGAGTGGGCTGGG + Intergenic
1105938290 13:25121876-25121898 TAAAAATCAAACAGAAGCCCTGG + Intergenic
1106166115 13:27248078-27248100 TAAAAATGATGGAGTTGGCTGGG + Intergenic
1106324313 13:28673362-28673384 TAAAAATAACAGATTCGGCCGGG - Intronic
1106403900 13:29456840-29456862 TAAATATAAAAGACTAGGCCGGG + Intronic
1106463185 13:29990445-29990467 TAAAAACAACACAGTAGGCCGGG + Intergenic
1106507845 13:30387083-30387105 TAAAAAAAATAAAGGAGGCCGGG + Intergenic
1106725964 13:32486378-32486400 TAAAAATAATAAACTGGGCCGGG + Intronic
1106855707 13:33849585-33849607 AAAGAATATTAGAGTAGGCCAGG + Intronic
1106882844 13:34150452-34150474 AAAAAATCTTAGAGAGGGCCAGG - Intergenic
1106929651 13:34650540-34650562 AAAATAACATACAGTAGGCCAGG - Intergenic
1107056575 13:36111128-36111150 TAAAAAACATTGATTAGGGCCGG - Intronic
1107089261 13:36459079-36459101 TAAAAATAAAATTGTAGGCCAGG - Intergenic
1107130306 13:36887516-36887538 TAAAAATGATCAAGTCGGCCAGG - Intronic
1107457311 13:40566672-40566694 TAAAAAATTTAAAGTAGGCCAGG - Intronic
1107529258 13:41266251-41266273 AAAAAACCATAGACTGGGCCAGG - Intergenic
1107636575 13:42398325-42398347 TAAAAATTATCAAGAAGGCCAGG + Intergenic
1107647087 13:42505514-42505536 TAAAAACCCTAGAAGAGGCCAGG - Intergenic
1107701433 13:43052256-43052278 TAAAAATCAAAAAATAGGCTGGG - Intronic
1107729726 13:43336543-43336565 TAAAATTCACAGTGTAGCCCAGG + Intronic
1107741254 13:43452815-43452837 TAAAAAGAATAAGGTAGGCCAGG - Intronic
1107944089 13:45401762-45401784 TAAAAATCATGACATAGGCCAGG + Intronic
1108097652 13:46921077-46921099 TAAAAGACACAGAGTGGGCCAGG - Intergenic
1108103645 13:46985038-46985060 TAAATATCATAGAGAAGGAAAGG + Intergenic
1108567584 13:51716395-51716417 TAAAAATCAACAAGTGGGCCGGG + Intronic
1109456425 13:62597350-62597372 TAAAAAGAATATATTAGGCCAGG - Intergenic
1109663453 13:65496890-65496912 TAAAAAGCATAGTATAGGCCGGG + Intergenic
1109680055 13:65739646-65739668 TAAAAATCATACAATAGGCCAGG - Intergenic
1109995148 13:70113213-70113235 TAAAAATCACATCATAGGCCAGG - Intergenic
1110007156 13:70287535-70287557 TTAAAAACATATATTAGGCCGGG + Intergenic
1110204678 13:72898539-72898561 TAAAATTGATAGATCAGGCCAGG + Intronic
1110208169 13:72942703-72942725 TAAAAATCCTTTAGTAGGCTGGG + Intronic
1110226630 13:73126267-73126289 TAAAATTCACATAATAGGCCAGG - Intergenic
1110323663 13:74188698-74188720 TTAAAAACAAAGAGTGGGCCAGG + Intergenic
1110420562 13:75303020-75303042 TAAAAATGAAAGAATAGGCCAGG + Intronic
1110571393 13:77008846-77008868 TAGAATTCTTATAGTAGGCCGGG - Intronic
1111413597 13:87910355-87910377 TAAAAATAAAACAATAGGCCGGG + Intergenic
1111493475 13:89017026-89017048 TAAAAATCACACAGTGGGGCCGG + Intergenic
1111639953 13:90955723-90955745 TAAAAATGACAGAGGAGGCTTGG - Intergenic
1111664432 13:91249253-91249275 TTAAAAACATAGTGTAGGCTGGG - Intergenic
1111845758 13:93506743-93506765 TAAAAAGCCCGGAGTAGGCCGGG + Intronic
1112057599 13:95705145-95705167 TCAAAAACACAGATTAGGCCAGG - Intronic
1112390975 13:98983910-98983932 AAAAAATAATTGAGGAGGCCGGG - Intronic
1112592007 13:100772202-100772224 TCAGAAACAAAGAGTAGGCCGGG - Intergenic
1113327008 13:109292205-109292227 TAAAAATCTTACTGTCGGCCGGG + Intergenic
1113516977 13:110911152-110911174 TAAAAAACTTTGTGTAGGCCGGG + Intronic
1114179255 14:20351471-20351493 TAAAATTCTTAGAGAAGGCAGGG - Intronic
1114440047 14:22738941-22738963 CAAAAATCATAAATTGGGCCAGG + Intergenic
1114630081 14:24153606-24153628 TAAAATACATAAAGTTGGCCAGG + Intronic
1114730054 14:24983093-24983115 AAAGAATCATAGTGAAGGCCAGG + Intronic
1114898471 14:27025464-27025486 AAAAAATCAAAAAGTAGGCCAGG - Intergenic
1115356334 14:32452327-32452349 TAAAAATTATAGCATAGGCTGGG - Intronic
1115591351 14:34868506-34868528 TAAAAATCAGAAACTAGGCCGGG + Intronic
1115603441 14:34977616-34977638 TAAAAATTATAGGAGAGGCCAGG + Intergenic
1115655727 14:35441843-35441865 TAAAATTCATATAGTGGGGCTGG - Intergenic
1115794708 14:36921847-36921869 TAAAAATTACAGCATAGGCCAGG + Intronic
1115830940 14:37340413-37340435 TAAAAAAGTTACAGTAGGCCAGG + Intronic
1115934995 14:38542594-38542616 TTAAAATAATACAGCAGGCCGGG + Intergenic
1116203846 14:41835514-41835536 TAAAAATTAATGAGTAAGCCTGG + Intronic
1116299121 14:43154447-43154469 AAAAAATTAGAGTGTAGGCCGGG - Intergenic
1116545390 14:46159361-46159383 TAAAAAGTAAAGTGTAGGCCAGG + Intergenic
1116753525 14:48917277-48917299 TAAAAACCATAGGTTAGGCCAGG + Intergenic
1116830570 14:49715414-49715436 TTAATATAATAAAGTAGGCCGGG - Intronic
1116945791 14:50833967-50833989 GAAGAAACAAAGAGTAGGCCAGG - Intergenic
1116992937 14:51294451-51294473 TTAAAATCAGAGAACAGGCCTGG + Intergenic
1117136684 14:52741732-52741754 TAAAAATCAGTGAATAGGCCAGG - Intronic
1117408235 14:55425970-55425992 TAAAAATTAAAGAGGGGGCCGGG + Intronic
1117728805 14:58700586-58700608 TAAAAATCATTTTTTAGGCCGGG - Intergenic
1117847007 14:59921788-59921810 TGAAAAGCACAAAGTAGGCCAGG + Intronic
1118031595 14:61823284-61823306 TAAAAATAAAAAAATAGGCCAGG - Intergenic
1118426216 14:65666291-65666313 CAAAAATCATAAAATAGGTCAGG - Intronic
1118509957 14:66461165-66461187 TAAAAATTGTGGACTAGGCCAGG + Intergenic
1118576496 14:67246634-67246656 AAAAAAACCTATAGTAGGCCAGG - Intronic
1118695523 14:68381378-68381400 AAAAAGCCATAGAGTTGGCCGGG + Intronic
1118826476 14:69387747-69387769 TTAAGATCCTAGACTAGGCCGGG + Intronic
1118863914 14:69687404-69687426 TTAAAATCATAAGCTAGGCCGGG - Intronic
1119052874 14:71387313-71387335 TAAAAATAGTTGACTAGGCCAGG + Intronic
1119827721 14:77671395-77671417 AAAAAAAAAAAGAGTAGGCCAGG - Intergenic
1120099190 14:80424619-80424641 TCAAAATCAATGAGCAGGCCAGG - Intergenic
1120878130 14:89393234-89393256 TAAAAAGAAGAGAGGAGGCCAGG - Intronic
1120927708 14:89814407-89814429 TAAAAATCACCCAGCAGGCCGGG + Intronic
1120998019 14:90431465-90431487 AATAAAGCATAGAGTAGGCCAGG + Intergenic
1121397356 14:93637751-93637773 CAAAAATTATAGAAGAGGCCAGG - Intronic
1121462371 14:94091473-94091495 TAAAAATCATATAGGAAGCATGG - Intronic
1121598468 14:95184811-95184833 GAAAAATCAGAGTGAAGGCCAGG + Exonic
1121657511 14:95608095-95608117 TAAAAAACATTGTGTGGGCCTGG + Intergenic
1121829186 14:97034697-97034719 TAAGAGACATAGAGGAGGCCGGG - Intergenic
1122273655 14:100580007-100580029 TTAAAATCACAGACCAGGCCGGG + Intronic
1122545903 14:102522592-102522614 TAAAACTCTTAGAGAAGGCCAGG + Intergenic
1122576453 14:102745996-102746018 TAAAAATAAAAGAATTGGCCGGG - Intergenic
1122763300 14:104046248-104046270 TTAAAAAGATAAAGTAGGCCAGG - Intronic
1123692263 15:22848086-22848108 TAAAAATCATCGACCAGGCGTGG - Intronic
1123904447 15:24907757-24907779 TTGAAAGCACAGAGTAGGCCAGG + Intronic
1123957030 15:25347404-25347426 TAAAAAACACATAGAAGGCCAGG + Intronic
1124210298 15:27757853-27757875 CCAAAATCACAGAGTAAGCCTGG + Intronic
1124704280 15:31948811-31948833 TAGAAATAAAATAGTAGGCCGGG - Intergenic
1124899066 15:33805770-33805792 TAAAAACAAAAGAGAAGGCCGGG - Intronic
1124952765 15:34338416-34338438 TTAAAACTATAAAGTAGGCCTGG + Intergenic
1125286949 15:38103528-38103550 TAGAAAACATAGAGAAGGCATGG + Intergenic
1125368938 15:38949272-38949294 TAAAAAGCATAAAGCAGGCCAGG + Intergenic
1125461723 15:39913749-39913771 AAAAAACCATCGAGTTGGCCGGG + Intronic
1125506237 15:40269314-40269336 TAAAAATAATAAAGCCGGCCTGG - Intronic
1125628024 15:41125054-41125076 TTAAAATAATATATTAGGCCAGG + Intergenic
1126007299 15:44270098-44270120 TAAAAATGATGGTATAGGCCAGG - Intergenic
1126020166 15:44392325-44392347 TAAAAATCCTAAACAAGGCCAGG + Intronic
1126355003 15:47786134-47786156 TGAAAAACACAGAATAGGCCAGG + Intergenic
1126405209 15:48316223-48316245 TAAAAATCTAAGACAAGGCCAGG + Intergenic
1126636386 15:50784459-50784481 TAAAAATGAAAATGTAGGCCAGG + Intergenic
1126704402 15:51394315-51394337 TAAAAATAATCCAGCAGGCCGGG + Intronic
1126806471 15:52354558-52354580 TAAAAAGAATGAAGTAGGCCGGG + Intronic
1127064438 15:55222338-55222360 AAAAACACATAGAGTAGGGCAGG - Intronic
1127078731 15:55353898-55353920 TAGAAAGACTAGAGTAGGCCGGG - Intronic
1127121839 15:55778584-55778606 TAAAAACCATAACATAGGCCAGG - Intergenic
1127469453 15:59277249-59277271 TAAAAATCAAAGTCTGGGCCAGG + Intronic
1127479416 15:59364742-59364764 TAAAAATAAAACAGTTGGCCGGG + Intronic
1127510269 15:59634066-59634088 AAAAAATCTTAGAATTGGCCGGG + Intronic
1127699500 15:61484271-61484293 TAAAAAATGTAGAATAGGCCGGG - Intergenic
1127870042 15:63064668-63064690 TAAGAATTCTAGAGTAGGCCGGG + Intronic
1128008946 15:64272511-64272533 TAAAAGTCACAGAGTGGGGCCGG - Intronic
1128102771 15:65017524-65017546 TAAAAAACAAAAAGAAGGCCAGG + Intronic
1128140077 15:65293482-65293504 TTAAAATCATAGATCTGGCCAGG + Intronic
1128644483 15:69365401-69365423 TAAAATTCATAAAGGAGGCTGGG - Intronic
1128772937 15:70295921-70295943 TAAAAAACAGAGTTTAGGCCTGG - Intergenic
1128826980 15:70728266-70728288 TAAAAATCATAGAAGAGGCCAGG + Intronic
1128831433 15:70772791-70772813 TAGAAATCAAAGAGAAGGCTGGG + Intergenic
1128837305 15:70820021-70820043 TAAAAAAGATAAACTAGGCCAGG - Intergenic
1128990472 15:72255551-72255573 GAAAAATCAGAGAGTGGGCTGGG - Intronic
1129048982 15:72762163-72762185 TAAAAATAAAAAATTAGGCCAGG - Intronic
1129196460 15:73970219-73970241 TAAAAATCAGAAAGGAGGCCGGG - Intergenic
1129347210 15:74930122-74930144 TAAAAAACTAAGACTAGGCCGGG + Intronic
1129371752 15:75100728-75100750 TAAAAAGCTAACAGTAGGCCAGG - Intronic
1129866333 15:78911584-78911606 TAAAACTGACAGAGTAGGCCAGG - Intergenic
1129873719 15:78958467-78958489 TACAAATTCTAGAGCAGGCCGGG - Intergenic
1130142336 15:81238195-81238217 TAAAATACAGAGACTAGGCCGGG - Intronic
1130194951 15:81771036-81771058 TAAAAAGCTTACACTAGGCCAGG + Intergenic
1130419086 15:83724391-83724413 TAAAAATAAATGAATAGGCCAGG - Intronic
1130530034 15:84740083-84740105 TAAAAATTGTAAAATAGGCCAGG - Intergenic
1130831750 15:87608109-87608131 TACAAATCACAGATCAGGCCAGG - Intergenic
1131146002 15:90012563-90012585 TAAAAATGAAAAAGTTGGCCAGG - Intronic
1131192767 15:90330522-90330544 TAAAAATAATACAATGGGCCGGG + Intergenic
1131886340 15:96918002-96918024 TAAAGATGATACACTAGGCCAGG - Intergenic
1131999277 15:98163182-98163204 TAAAAATCCTGGACTCGGCCGGG - Intergenic
1132071457 15:98780253-98780275 TTAAATTAACAGAGTAGGCCGGG + Intronic
1132201611 15:99958202-99958224 TAAAAATTAAAGTGTAGGCAGGG - Intergenic
1132403757 15:101529975-101529997 TAAAAAGCATCCAGAAGGCCAGG - Intergenic
1132493456 16:247726-247748 TAAAAATCATTAATAAGGCCAGG - Intronic
1133109443 16:3537701-3537723 TAAAAAGCGTACAGTAGGTCAGG + Exonic
1133229283 16:4359064-4359086 TAAAAATCATACTGTAGGCCGGG - Intronic
1133243331 16:4429514-4429536 TAAAAATCTTTTTGTAGGCCGGG - Intronic
1133266119 16:4585159-4585181 TAAAAAGCATAAATAAGGCCAGG + Intronic
1133296349 16:4754362-4754384 TAAAAAACTGAGAGGAGGCCGGG + Intronic
1133388571 16:5390582-5390604 TAAAAATAATATATGAGGCCAGG - Intergenic
1133421238 16:5648766-5648788 TAAAAATCACATTTTAGGCCAGG + Intergenic
1133687770 16:8182510-8182532 TAAAATACCTAGAATAGGCCAGG - Intergenic
1133831904 16:9331014-9331036 TAAGAATCATTGAATAGGCTGGG + Intergenic
1133908640 16:10044349-10044371 TAAAAATGATATTGTAGGCCGGG - Intronic
1133955126 16:10436063-10436085 TAAAAATAATAGTATTGGCCGGG + Intronic
1134157912 16:11858985-11859007 TAAAAAGTATAGTATAGGCCGGG - Intergenic
1134534556 16:15015235-15015257 TAAAAATCATATAGGTGGGCTGG - Intronic
1135164196 16:20124329-20124351 TAAAACTCATAGGTGAGGCCAGG + Intergenic
1135434422 16:22416603-22416625 TAAAAATAAAACATTAGGCCGGG + Intronic
1135736555 16:24936408-24936430 TAAAAAACAAACAGCAGGCCAGG + Intronic
1135938468 16:26800686-26800708 TAAAAAACACAGAGTAAGGCTGG - Intergenic
1136543142 16:30939959-30939981 TAAAAATAAAAAAATAGGCCAGG + Intronic
1136565436 16:31066892-31066914 TAAAAATGATAGCTTGGGCCAGG + Intronic
1136624542 16:31454009-31454031 TATAAATAATAAAGCAGGCCGGG + Intergenic
1136986737 16:35113263-35113285 TAAAAAACATGGAGTTGGCTGGG + Intergenic
1137482438 16:48863838-48863860 TAAAGATCAAGGAGGAGGCCGGG - Intergenic
1137678873 16:50321263-50321285 TAAAAAGGATGGAGTTGGCCTGG + Intronic
1137921284 16:52490922-52490944 TAAAAATCACATCTTAGGCCAGG - Intronic
1138174085 16:54880392-54880414 TAACAAGCATAGAGAAGGGCTGG + Intergenic
1138210150 16:55156553-55156575 TAAAAAGCAAAGATTTGGCCAGG - Intergenic
1138586626 16:57974614-57974636 TAAAAATCATGAGTTAGGCCGGG - Intergenic
1138764251 16:59582316-59582338 TAAAAACCATAGAAAAGGCTGGG + Intergenic
1138806100 16:60090547-60090569 TAAAAATAATATCATAGGCCGGG - Intergenic
1139019930 16:62736318-62736340 TGAAAATGCTTGAGTAGGCCGGG + Intergenic
1139055767 16:63181532-63181554 TAAAAAGCATACACTGGGCCAGG - Intergenic
1139074775 16:63430969-63430991 TAAAAATCATAAAGTAAGAAAGG + Intergenic
1139080523 16:63513677-63513699 TAAAAATCATACTATAGGCCGGG + Intergenic
1139130938 16:64143836-64143858 TGAAAATCAAAGATTAGGCCGGG - Intergenic
1139533359 16:67555393-67555415 TTAAAATGTTAGAATAGGCCGGG + Intergenic
1139610847 16:68057435-68057457 TAAAAAAAAGAGAGGAGGCCGGG + Intronic
1139611528 16:68062422-68062444 TTAAGATCATATAGTAGGCCGGG + Intronic
1139716868 16:68820643-68820665 TAAAAATTAAACAGCAGGCCAGG - Intronic
1139765577 16:69226359-69226381 TAAGAATCATAGGGTGGGCATGG - Intronic
1139781513 16:69355278-69355300 TAAAATTCATCCATTAGGCCAGG - Intronic
1139787453 16:69405340-69405362 GAAAATTCAGGGAGTAGGCCGGG - Intronic
1139809202 16:69598727-69598749 TAAAAATGTCAGCGTAGGCCGGG + Intronic
1139861490 16:70025546-70025568 TAAAAATCATATAGGTGGGCTGG + Intergenic
1139874796 16:70137055-70137077 TAAAAATTAGACACTAGGCCGGG + Intronic
1139986410 16:70901877-70901899 TAAAAATCATATGCTTGGCCGGG - Intronic
1140360989 16:74344087-74344109 TAAAAATTAGACACTAGGCCGGG - Intergenic
1140598861 16:76450443-76450465 AAAAAATCACAGAGCAGGCTGGG - Intronic
1140680636 16:77381506-77381528 TTAAAATCAGAGAGTCGGCTGGG + Intronic
1140764029 16:78139347-78139369 TAAAAAGCAGACAGTAGGTCTGG + Intronic
1140804731 16:78522774-78522796 TAAAAATCTAACAGTGGGCCAGG + Intronic
1141129138 16:81423164-81423186 TAAGAATGATACAGTGGGCCAGG + Intergenic
1141218045 16:82043387-82043409 TAAAAATCATATAGATGGCCGGG + Intronic
1141413626 16:83853530-83853552 TAAAAATAAAAGATTAAGCCTGG - Intergenic
1142792336 17:2277074-2277096 AAAAAGACATAAAGTAGGCCGGG - Intronic
1143077145 17:4353976-4353998 TAAAAATGCTGGGGTAGGCCAGG - Intronic
1143103618 17:4517360-4517382 CAAAATTAATAGAGCAGGCCAGG + Intronic
1143225495 17:5298948-5298970 TTAAAATCCTGGAGGAGGCCGGG - Intronic
1143453118 17:7048500-7048522 TAAAAACAAAAGAGAAGGCCGGG + Intergenic
1143629678 17:8131291-8131313 TAAAAATAATAAGGGAGGCCGGG + Intergenic
1143716880 17:8779412-8779434 TAAAAATCAGAAAGTAGGCCAGG + Intergenic
1143956844 17:10677009-10677031 TAAAAAGCACAAACTAGGCCGGG + Exonic
1144055182 17:11534301-11534323 TCAAAATGTTAGAATAGGCCGGG - Intronic
1144452969 17:15396513-15396535 TAAAAATGACTGGGTAGGCCGGG + Intergenic
1144622343 17:16825460-16825482 TAAAAAGCAGAGAGGCGGCCGGG + Intergenic
1144791830 17:17864162-17864184 TAAAAAAGGTATAGTAGGCCAGG - Intronic
1144799587 17:17916366-17916388 TAAAAATCTTAAAATAGGCCGGG - Intronic
1144884083 17:18447253-18447275 TAAAAAGCAGAGAGGTGGCCGGG - Intergenic
1145148148 17:20497124-20497146 TAAAAAGCAGAGAGGTGGCCGGG + Intergenic
1145739172 17:27257999-27258021 AAAAAATAATAAAGAAGGCCAGG + Intergenic
1145743718 17:27297462-27297484 AAAAAAAAAAAGAGTAGGCCGGG - Intronic
1145855972 17:28157620-28157642 AAAAACTAATAAAGTAGGCCAGG - Intronic
1145952552 17:28830688-28830710 TAAATCTCATAGTTTAGGCCGGG + Intronic
1146233905 17:31139340-31139362 TTAAGATCTAAGAGTAGGCCAGG - Intronic
1146235284 17:31154350-31154372 TAAAAATCAGAGAAATGGCCAGG - Intronic
1146321150 17:31847585-31847607 TAAAAATAGTAAATTAGGCCAGG + Intergenic
1146516957 17:33496911-33496933 TAAAAAGCCTAAAATAGGCCAGG - Intronic
1146565920 17:33912681-33912703 TAAAAATTATAGACTAGGGCCGG + Intronic
1146934728 17:36805881-36805903 TAAAAAAAAAAGAATAGGCCGGG + Intergenic
1146940096 17:36838460-36838482 TAAAAATTATCTTGTAGGCCAGG + Intergenic
1146941888 17:36849100-36849122 TAAAAATCAGTGGGTGGGCCGGG - Intergenic
1147058856 17:37857832-37857854 TAAAAATCATAAAGAAGGCCAGG + Intergenic
1147220664 17:38927745-38927767 TAAAAATTATGGACAAGGCCGGG + Intergenic
1147255986 17:39182403-39182425 CATAAATCAGAGAGTAGGCTGGG + Intronic
1147298741 17:39506509-39506531 TAAAAATCATATAATTGGCCAGG - Intronic
1147470632 17:40656911-40656933 TAAAAATCACAGTATAGGCTGGG + Intronic
1147519376 17:41154828-41154850 TAAAAATAATAGAAGAGGCCGGG - Intergenic
1147576687 17:41605384-41605406 TAAAAAGCAGAGAGGCGGCCGGG + Intergenic
1147600995 17:41745392-41745414 TAAAAACAATAGAGTTGGCCAGG + Intergenic
1147627935 17:41911817-41911839 AAAAAAAAATAAAGTAGGCCGGG + Intronic
1148034648 17:44650197-44650219 TAAAAATCCAATAGTAGGGCCGG + Intergenic
1148292956 17:46472610-46472632 TAAAAATCATATCATCGGCCAGG + Intergenic
1148315140 17:46690307-46690329 TAAAAATCATATCATCGGCCAGG + Intronic
1148369747 17:47089336-47089358 TAAAAAAGACAGAGTAGACCGGG - Intergenic
1148425781 17:47594925-47594947 TAAAAAAAATAAAATAGGCCAGG - Intronic
1148482138 17:47966902-47966924 TACAGATCATACAGTGGGCCAGG - Intergenic
1148482185 17:47967226-47967248 TGAAAATCATCCAGTGGGCCAGG - Intergenic
1148723304 17:49770606-49770628 TAAAAATAATAGAATCGGCCAGG + Intronic
1148773870 17:50082470-50082492 TAAAAATAAAAAATTAGGCCAGG - Intronic
1148932881 17:51141443-51141465 TAAAAATAATAAAATAGGCCGGG - Intergenic
1148937215 17:51173091-51173113 TAAAAAGCATAGAATTGGCCGGG - Intergenic
1149471510 17:56919631-56919653 TAAATCTCATAGAAGAGGCCAGG - Intergenic
1149476795 17:56967727-56967749 TAAAAACCCTAGAGTAGGCCAGG - Intergenic
1149519495 17:57307732-57307754 TGAAAATCCTAGGGCAGGCCAGG - Intronic
1149709786 17:58729864-58729886 TAAGAATCCTAAAGTCGGCCGGG - Intronic
1149767477 17:59291394-59291416 CAAAAATAATACAGGAGGCCAGG + Intergenic
1149804944 17:59607990-59608012 TGGAAATAACAGAGTAGGCCAGG - Exonic
1149905238 17:60520275-60520297 AAAAAATCATTAAGGAGGCCGGG + Intronic
1150076373 17:62195680-62195702 TAAAAATCAGATGGTTGGCCGGG - Intergenic
1150082415 17:62252019-62252041 TAAAAAACAAAAAATAGGCCTGG + Intergenic
1150329160 17:64281281-64281303 TAAAAATGATAAAACAGGCCAGG + Intergenic
1150542054 17:66111993-66112015 TAAAAATCAATGAAAAGGCCGGG + Intronic
1150589935 17:66553276-66553298 TAAAAATCATTCATCAGGCCAGG - Intronic
1150721407 17:67617208-67617230 TAAAAACCAGAGAGTTGGCTGGG + Intronic
1150757022 17:67923773-67923795 TAAAAATAAGAGAGAGGGCCGGG - Intronic
1151050825 17:70977643-70977665 TAAAAATTATAATGTAGCCCTGG - Intergenic
1151427351 17:74039732-74039754 TAAACAACATAGAATGGGCCGGG + Intergenic
1151599401 17:75097119-75097141 TAAAAGTGACAGAGTAGGCTGGG - Intronic
1151607832 17:75151012-75151034 TAAAAATAAAAGAGTTAGCCGGG - Intronic
1151672383 17:75578478-75578500 TAAAAATAAAAAAGTAGGACAGG - Intergenic
1151762969 17:76117164-76117186 TAATAATAATAAAATAGGCCGGG - Intronic
1151886348 17:76925274-76925296 TAAATATCATTGAGTTAGCCGGG - Intronic
1152054214 17:78009846-78009868 TAAAAATCATAATTCAGGCCAGG - Intronic
1152116853 17:78393353-78393375 TAAGAATCAAAGTCTAGGCCGGG - Intronic
1152840292 17:82563100-82563122 TAAAAAGCACAGACAAGGCCAGG - Intronic
1152851868 17:82641598-82641620 TAAAAATCCAAGAGGTGGCCGGG + Intronic
1152908891 17:82985865-82985887 TAAAAATCATCGTGTATTCCAGG + Intronic
1153197979 18:2622111-2622133 TCAAAATCCTAGACTCGGCCGGG + Intergenic
1153320062 18:3763955-3763977 TAAGAATGACAGAATAGGCCAGG - Intronic
1153683359 18:7522020-7522042 TGAAAACAATAGAGCAGGCCGGG + Intergenic
1153705141 18:7737388-7737410 TAAAAATTCCAGAGTTGGCCGGG - Intronic
1153798686 18:8648909-8648931 TAAAAGACACAGAGTGGGCCAGG + Intergenic
1154159591 18:11971393-11971415 TAAACATCAAAAAGTAGGCCGGG - Intergenic
1154196781 18:12272641-12272663 TAAAAATCAAAGCTGAGGCCGGG - Intronic
1154255936 18:12780818-12780840 TAAAAAACACAGTATAGGCCAGG - Intergenic
1154260777 18:12830426-12830448 TAAAAATTAAGGATTAGGCCAGG - Intronic
1154987291 18:21564760-21564782 TAAAAATCAAGGAGCAGGCCTGG + Intronic
1154988859 18:21581014-21581036 AAAAAATAACAGGGTAGGCCGGG + Intronic
1155184198 18:23373016-23373038 TAAAAATCATTTTGCAGGCCAGG + Intronic
1155264329 18:24076273-24076295 GAAAAACCACAGAGCAGGCCGGG - Intronic
1155487854 18:26366083-26366105 TAAAAATAAAATAATAGGCCGGG - Intronic
1155503680 18:26512396-26512418 TAAGAATCTCAGAGGAGGCCAGG - Intronic
1155640344 18:28006420-28006442 TAAAAATGTGAAAGTAGGCCAGG + Intronic
1155881887 18:31159346-31159368 TAAAAACCACATAGTAGGCCGGG - Intronic
1155926867 18:31665442-31665464 TAAAAAGACAAGAGTAGGCCGGG + Intronic
1155996488 18:32336133-32336155 TAAAAACCATACAGTAGGCCGGG + Intronic
1156413017 18:36853951-36853973 TAAAAAGCACACAGTGGGCCGGG - Intronic
1157103810 18:44754513-44754535 ATGAAATCATAGAATAGGCCAGG + Intronic
1157246686 18:46061006-46061028 AAAAAATCATACAGGAGGCTGGG + Intronic
1157254758 18:46128853-46128875 TAAAAATCAAACATTAGGCTGGG - Intergenic
1158029197 18:52942076-52942098 TAAAAATCAGAAAATGGGCCAGG - Intronic
1158448972 18:57546663-57546685 TAAGATTTATTGAGTAGGCCGGG + Intergenic
1158488944 18:57892983-57893005 TAAAAGCCAAATAGTAGGCCGGG - Intergenic
1158514742 18:58121702-58121724 TAGAAAACATATAGTTGGCCAGG - Intronic
1158611674 18:58946022-58946044 TAAAAAGGATAGACTTGGCCGGG - Intronic
1159116117 18:64114842-64114864 AAAAAAACATAAAATAGGCCAGG - Intergenic
1159147180 18:64469219-64469241 TGAAAATCATAGAGTTGGACTGG + Intergenic
1159538851 18:69749643-69749665 TAAAAATCAATGAGTTGGCCGGG + Intronic
1159621507 18:70644338-70644360 TAATAATTAAAGAGGAGGCCGGG + Intronic
1159804889 18:72944049-72944071 TTAAAATCATTGCTTAGGCCAGG - Intergenic
1160044942 18:75377996-75378018 TTAAAATGAAAGAGTTGGCCAGG - Intergenic
1160287504 18:77558488-77558510 AAAAAATCATATAATAGGCCAGG - Intergenic
1160513269 18:79464388-79464410 TAAAAATGAAACAGCAGGCCGGG - Intronic
1161279328 19:3436768-3436790 TAAAAATCCTACAGGTGGCCGGG - Intronic
1161634636 19:5379984-5380006 TAAAAAGCAAAAAGTAGGCTGGG + Intergenic
1161872590 19:6881835-6881857 TAAAAATTACAGAGGGGGCCGGG + Intergenic
1161938729 19:7388874-7388896 TAAAAATCAAAGGGCAGGCCAGG - Intronic
1161940908 19:7403236-7403258 TAAAAATCACTGATTTGGCCGGG - Intronic
1161942187 19:7412308-7412330 TAAAAACCCTAGCATAGGCCGGG - Intronic
1161988701 19:7671526-7671548 TAAAAATTAAAAAATAGGCCAGG - Intergenic
1162005738 19:7777774-7777796 TAAAAATCCTAGAGTAGGCCAGG - Intergenic
1162137776 19:8566460-8566482 TAAAAAGCATAGACCAGGCCGGG - Intronic
1162223228 19:9197393-9197415 TAAAAACCAAAGAGTTGGCTGGG - Intergenic
1162335156 19:10055623-10055645 TCGTCATCATAGAGTAGGCCAGG - Intergenic
1162382058 19:10337119-10337141 GAAAAGTCAAAAAGTAGGCCAGG + Intronic
1162407556 19:10484497-10484519 TAAAATTCATAGGCTGGGCCAGG - Intergenic
1162414928 19:10530047-10530069 TAAAAATCAGAAAATAGGTCTGG - Intergenic
1162583270 19:11543483-11543505 TAATAATAAAAGAGTGGGCCGGG + Intronic
1162877196 19:13629316-13629338 TAAAAATCCTAGGCTTGGCCAGG + Intergenic
1163014443 19:14445597-14445619 GAAAATGAATAGAGTAGGCCAGG + Intronic
1163369705 19:16895112-16895134 GAAAAATAAAAGAATAGGCCTGG + Intronic
1163505019 19:17700521-17700543 TTAAAATCATAAAGCAGGCCGGG - Intergenic
1163541445 19:17913340-17913362 TGAAATTCTTAGAATAGGCCAGG - Intergenic
1163615812 19:18327488-18327510 TAAAAATTTTAAAATAGGCCAGG + Intergenic
1163889677 19:19999827-19999849 TAAAAATTATGGTGTAGGCTGGG - Intronic
1163969489 19:20778393-20778415 TAAAAATAATGCAGTAGGCCGGG - Intronic
1164042890 19:21509292-21509314 AAAAAATCATGTAGTAGGCCGGG - Intronic
1164162006 19:22633309-22633331 TAAAAATCAAAATGCAGGCCAGG + Intergenic
1164176541 19:22780395-22780417 TAAAAATCATGTAGTAGGCCAGG + Intronic
1164272169 19:23682891-23682913 TAAAAGTTATGTAGTAGGCCGGG + Intronic
1164615457 19:29664739-29664761 TAAAAAGCTTAAAATAGGCCAGG + Intergenic
1164651770 19:29895834-29895856 AAAAAATCAGAGGGGAGGCCAGG + Intergenic
1164974626 19:32563143-32563165 TAAAAAACATAAAATTGGCCAGG + Intergenic
1165026611 19:32967119-32967141 TAAAGATAAGAGAGTGGGCCAGG - Intronic
1165208326 19:34210865-34210887 TAAAAATTCCAGAATAGGCCGGG - Intronic
1165342259 19:35221403-35221425 TAAAAATACAAGAGTTGGCCAGG - Intergenic
1165490322 19:36119590-36119612 TAAAAACCAAAGTCTAGGCCAGG + Intronic
1165591980 19:36976613-36976635 TAAAAATGGTAGAGCTGGCCGGG + Intronic
1165639233 19:37370304-37370326 TAATAATAATAAAATAGGCCGGG + Intergenic
1165664462 19:37615341-37615363 TAAAAGTGACAGAGCAGGCCGGG - Intronic
1165679217 19:37759430-37759452 TAAAAATTATAGTTTAGACCAGG + Intronic
1165798015 19:38530247-38530269 AAAAAATAAAAAAGTAGGCCAGG - Intronic
1165928032 19:39339391-39339413 TAAAAACCAAACAGCAGGCCAGG + Intronic
1166034644 19:40159050-40159072 TAAAAATCATATTGTAGGTTAGG + Intergenic
1166533705 19:43558334-43558356 CAAAAAAAAAAGAGTAGGCCAGG + Intronic
1166689877 19:44816020-44816042 TAAAAATAAAAAAGTAGGCCGGG + Intronic
1166780188 19:45338133-45338155 TAAAAAAGCTAGAGTAGGCCGGG + Intronic
1166890582 19:45989931-45989953 CAAAAACCTTAGAGTTGGCCGGG + Intergenic
1167094439 19:47366867-47366889 TAAAATTCCTAGTGTTGGCCGGG - Intronic
1167122350 19:47525616-47525638 TAAAACTTCTAGAGAAGGCCGGG + Intronic
1167302658 19:48687736-48687758 TAAAAAACAGAAAGTAGGGCCGG - Intergenic
1167330184 19:48850842-48850864 TAAAAATAAAAGAGTAGGCCAGG + Intronic
1167350745 19:48972772-48972794 TAAGAATTATAGATCAGGCCAGG - Intronic
1167405617 19:49306001-49306023 TTAAAAGCACAGATTAGGCCTGG + Intronic
1167451300 19:49571279-49571301 TAAAAATCAAAGAGTTTGCCGGG - Intronic
1167496622 19:49822940-49822962 TAAAAAACAGAATGTAGGCCAGG - Intronic
1167876597 19:52419087-52419109 TAAAAATGAAAGTGTGGGCCAGG - Intergenic
1167895715 19:52579229-52579251 TAAAGATCTTAAAGTTGGCCAGG + Intronic
1167899875 19:52611994-52612016 AAAAAATCATAGTGGAGCCCGGG - Intronic
1167909926 19:52693357-52693379 TAATAATAATAAAATAGGCCAGG + Intergenic
1167914542 19:52730096-52730118 TAAAAAACATGATGTAGGCCGGG + Intronic
1168054731 19:53856508-53856530 TAAAATTCTTAGAATAGGCTGGG - Intergenic
1168081069 19:54010874-54010896 TAAAAATAAAAGAGGAGGCTGGG - Intronic
1168091762 19:54090204-54090226 AAAAAAAAATACAGTAGGCCAGG - Intergenic
1168116971 19:54227778-54227800 TAAAAATGATAGAGACGGCTGGG - Intronic
1168261057 19:55194890-55194912 TAAAAATGAATGGGTAGGCCAGG + Intronic
1168285000 19:55326873-55326895 TAAAATGCTTAGAGTGGGCCGGG + Intronic
1168383055 19:55940507-55940529 TAAAAATTAAAAAGCAGGCCGGG - Intergenic
1168482207 19:56730424-56730446 TAAAAAGCAAAGACTAGGCGTGG + Intergenic
1168487058 19:56772496-56772518 TAAAAATCATAGTTCAGGCCAGG + Intergenic
925155215 2:1643775-1643797 TAAAAATGACAGTGTTGGCCAGG + Intronic
925324284 2:3005373-3005395 TAAGAATGCTACAGTAGGCCAGG - Intergenic
925583851 2:5442876-5442898 TAAAAAGGATAAAGTAGGCCGGG - Intergenic
925625557 2:5839410-5839432 TAAAACTCATGGAATGGGCCAGG - Intergenic
925713392 2:6763458-6763480 TAAAAATCCTACATTAGGCTAGG + Intergenic
925739097 2:6989580-6989602 AAAAAATCATTGAGGAGGTCAGG - Intronic
925792783 2:7509762-7509784 AAAAAATCAGAATGTAGGCCAGG - Intergenic
925909030 2:8559772-8559794 TAAAAATGATTAAGCAGGCCAGG - Intergenic
925975052 2:9136592-9136614 TAAAAATGATAGCACAGGCCGGG + Intergenic
926032417 2:9603625-9603647 TTAAAACCATAAAATAGGCCAGG + Intronic
926071029 2:9891065-9891087 TTAAAGTAAGAGAGTAGGCCAGG - Intronic
926204067 2:10822555-10822577 TAAAAATCATTTATGAGGCCAGG - Intronic
926504168 2:13690453-13690475 TAAAAACCATTGAGATGGCCAGG - Intergenic
927579013 2:24224923-24224945 TAAAAATTTAAGAGCAGGCCAGG - Intronic
927621564 2:24666307-24666329 TAATAATAAAAAAGTAGGCCAGG - Intronic
927983923 2:27394055-27394077 TAAAAATAAAAAATTAGGCCGGG - Intronic
928008795 2:27587570-27587592 TAAAAACCACAAATTAGGCCAGG - Intronic
928040722 2:27873994-27874016 TAAAAATCATAAAGAAGGTAAGG + Intronic
928294413 2:30070432-30070454 TGAAAAATATAGAATAGGCCGGG + Intergenic
928507001 2:31964399-31964421 TAAAAATCACCGAGTAGGCCGGG + Intronic
928761263 2:34586241-34586263 TAAAAATAGGAGAGTGGGCCGGG + Intergenic
928934519 2:36661628-36661650 TACATAACATTGAGTAGGCCAGG + Intergenic
928937371 2:36693456-36693478 TAAAAATCAAGTAGTAGGGCCGG + Intergenic
929351839 2:40965668-40965690 TAGAAAACAAAGAGTAGGCAGGG - Intergenic
929467413 2:42157597-42157619 TAAAAATCATAGTGTAGGCCGGG - Intergenic
929506641 2:42533382-42533404 TAGAAAACATGGAGTTGGCCAGG - Intronic
929512877 2:42579585-42579607 AAAAAACCATATACTAGGCCAGG - Intronic
929800040 2:45092138-45092160 TTAAAATGAAAGTGTAGGCCAGG - Intergenic
930128927 2:47828354-47828376 TAAATATGACAAAGTAGGCCAGG + Intronic
930157189 2:48117934-48117956 TAAAAATCTAGTAGTAGGCCAGG + Intergenic
930240437 2:48930584-48930606 TAAAAATCATAGTGTTGCCCAGG - Intergenic
930299377 2:49595275-49595297 TAAAAATGATACAGTAGGCTAGG + Intergenic
930366671 2:50447709-50447731 TAAAAATCACATAGTAAGCAGGG + Intronic
930794323 2:55371779-55371801 TAATAATTATAGAGTGGGCTAGG - Intronic
931592709 2:63902671-63902693 TAAAAATAACTGATTAGGCCGGG + Intronic
932400578 2:71478510-71478532 TAAAAATTATTGAGGATGCCTGG - Intronic
932718086 2:74117370-74117392 AAAAAATAATAAAATAGGCCGGG - Intergenic
932789560 2:74642123-74642145 TAAAATTAATTGAGGAGGCCAGG - Intronic
932822415 2:74912598-74912620 TAAAAATCCAAAAGTCGGCCAGG - Intergenic
933031239 2:77331418-77331440 TCCAATTCTTAGAGTAGGCCTGG - Intronic
933122004 2:78550420-78550442 TAAAAATGTAAGTGTAGGCCGGG + Intergenic
933900273 2:86844801-86844823 CAAAGATCATAGACTCGGCCGGG - Intronic
934876251 2:97923791-97923813 TAAAAAAGTTAGATTAGGCCGGG + Intronic
934990773 2:98920047-98920069 TAAAAAACGTATTGTAGGCCAGG - Intronic
935083372 2:99821347-99821369 TAAAAATTATAGTATAGTCCAGG + Intronic
935154913 2:100475702-100475724 TAAAAAGAAAAAAGTAGGCCGGG + Intronic
935621322 2:105132542-105132564 TAAAAATCTTAGAAGAGGCCGGG + Intergenic
935780276 2:106504424-106504446 CAAAGATCATAGACTCGGCCGGG + Intergenic
935850070 2:107209055-107209077 GAAAAATTTTAGATTAGGCCAGG + Intergenic
935951076 2:108329383-108329405 TAAAAATTAAAGAATAAGCCAGG + Intergenic
936391242 2:112076090-112076112 TAAAAACCACACATTAGGCCGGG + Intronic
936466996 2:112762753-112762775 TAAAGAACTTAGTGTAGGCCTGG - Intronic
936474352 2:112826791-112826813 CAAAAATCAAACTGTAGGCCAGG + Intergenic
936495244 2:113014758-113014780 TAAAAAAGATAGATTTGGCCAGG - Intergenic
936864657 2:117063617-117063639 TAAAAATAATAGATTAAGCCTGG + Intergenic
937135387 2:119547262-119547284 AAAAAATCATAGAATAGGCCAGG + Intronic
938318793 2:130348220-130348242 AAAAAAGCATACAGAAGGCCTGG + Intergenic
938395155 2:130940543-130940565 GAAAATTCATGGAGTAGGCCGGG + Intronic
938819391 2:134939759-134939781 TAAAAATCATATGATAGGCCGGG - Intronic
938886592 2:135655787-135655809 GAAAAAGAACAGAGTAGGCCAGG - Intronic
939121890 2:138127062-138127084 TTAAAATCAAAGTGTAGGCAAGG - Intergenic
940439945 2:153702512-153702534 AAAAAATAATAGCTTAGGCCAGG + Intergenic
940580740 2:155576195-155576217 TAAAATAAATAGAATAGGCCAGG + Intergenic
940600883 2:155858372-155858394 GAAAAATCATAATATAGGCCAGG + Intergenic
940943845 2:159594106-159594128 TAAAAAACAAAAAGTCGGCCGGG + Intronic
941911315 2:170767974-170767996 TAAAAATCAGGGAGTTAGCCAGG + Intergenic
942067932 2:172289304-172289326 TAAAAATCATGGTGTTGGCCGGG - Intergenic
942188771 2:173449918-173449940 TAAAAATTATATTGTAGGCCGGG - Intergenic
942396538 2:175555778-175555800 TAAAAATCAGATGGAAGGCCAGG - Intergenic
942600714 2:177638292-177638314 TAAAAAAAATATAGTAGGCTGGG - Intronic
942921350 2:181376941-181376963 TAAAAAAAATAGAATAGGCAAGG + Intergenic
943017661 2:182533017-182533039 TAAAAAGCAAAGAAGAGGCCAGG + Intergenic
943329553 2:186542618-186542640 AAAAAATGAAAGAGTAGGCCAGG - Intergenic
943346807 2:186748216-186748238 TAAAAATGGTAGAACAGGCCTGG - Intronic
943358774 2:186893369-186893391 TGAAAATCACAGAATAGGTCAGG + Intergenic
943741635 2:191416517-191416539 TAAGAGTCAGAGAGTAGGCCAGG + Intronic
944047234 2:195427089-195427111 TAAAAAACACACACTAGGCCAGG - Intergenic
944768678 2:202890472-202890494 AAAAATTCATTGAGCAGGCCGGG + Intronic
944807366 2:203295650-203295672 TAGAAATAATAAAGTAGGCCGGG + Intronic
945260745 2:207841174-207841196 TAAAAATAATAGACTGGGCGCGG + Intronic
945806379 2:214494929-214494951 TAGAAATCTAAGAGTTGGCCTGG - Intronic
945883643 2:215352284-215352306 TAAAACTCAGAAAATAGGCCGGG + Intergenic
945972795 2:216246509-216246531 TTAAAAACAATGAGTAGGCCGGG - Intergenic
946210179 2:218141367-218141389 TAAAAATAATGAAGTAGGGCTGG + Intergenic
946323307 2:218967110-218967132 TAAAAATTATACATCAGGCCGGG + Intergenic
947173689 2:227338534-227338556 TAAAAACCATAATGTCGGCCGGG + Intronic
947203245 2:227635547-227635569 TAATAATCACAAATTAGGCCAGG + Intergenic
947205449 2:227656913-227656935 TAAAAATAACACTGTAGGCCAGG - Intergenic
947452165 2:230218927-230218949 TAGAAAGCATAAAGAAGGCCAGG + Intronic
947491236 2:230596165-230596187 TAAAAGTCACAGAGTGGGCCAGG + Intergenic
947568114 2:231208776-231208798 TAAAAATCCTTGACTAGGCATGG + Intronic
947629044 2:231639920-231639942 TAAAATTCACAGAAGAGGCCGGG - Intergenic
947826667 2:233110348-233110370 TAAAAATAAAAAATTAGGCCAGG - Intronic
947852576 2:233300232-233300254 TAAAAATGTAATAGTAGGCCAGG + Intergenic
948533049 2:238625489-238625511 TAAAAATCATGTTCTAGGCCAGG - Intergenic
1168809980 20:698916-698938 TAAGAATCATGGAGTTGGCCGGG + Intergenic
1168814878 20:729403-729425 TAATAATCATGGGTTAGGCCGGG + Intergenic
1168885317 20:1247848-1247870 GAAAAATTATGAAGTAGGCCAGG + Intronic
1168937750 20:1681534-1681556 CAAAAATTATAAAGTTGGCCAGG + Intergenic
1169148586 20:3271106-3271128 TTAAAATAATAGAGGAGGCCGGG - Intronic
1169397995 20:5252356-5252378 TAAAAAATAAAGAGAAGGCCAGG - Intergenic
1169529328 20:6467231-6467253 TTAAAATCATCGTGTAGGCTGGG + Intergenic
1169566093 20:6855093-6855115 TAAAAACAGTAGAGCAGGCCAGG - Intergenic
1169930446 20:10827280-10827302 TAAAACGCTTAGAATAGGCCAGG + Intergenic
1169982223 20:11397219-11397241 TAAATAACATACAATAGGCCAGG + Intergenic
1170023976 20:11868398-11868420 TAAAAATCATAGACCAGGTGTGG - Intergenic
1170227867 20:14011822-14011844 AGAAAATCATAGGGGAGGCCAGG - Intronic
1170287008 20:14720957-14720979 TAAAACTCAAGGAGTTGGCCGGG + Intronic
1170383186 20:15784851-15784873 TAAAAATCACGGAGTAGGCCGGG + Intronic
1170462767 20:16593815-16593837 TAAAAATAAAAGAATTGGCCAGG + Intergenic
1171058972 20:21937450-21937472 TAATAATAATAGTGAAGGCCTGG + Intergenic
1171564525 20:26168369-26168391 TAAAAATGACATAATAGGCCGGG + Intergenic
1172064890 20:32212424-32212446 TAAAAATCAAAGAATTAGCCGGG - Intronic
1172074800 20:32287304-32287326 TAAAAAAAATAGATTGGGCCTGG - Intronic
1172311302 20:33920453-33920475 TAAAAAACATATAACAGGCCGGG - Intergenic
1172398507 20:34628552-34628574 TAAAAATGATAGACTAGAACTGG + Intronic
1172688832 20:36776734-36776756 TGAAACTCACAGACTAGGCCAGG - Intergenic
1172746323 20:37212063-37212085 TAAAAATCATTGTAAAGGCCAGG - Intronic
1172747272 20:37221491-37221513 TAAAAAGAACAGACTAGGCCGGG - Intronic
1172817595 20:37700294-37700316 TAAAATTCAGAGACTAAGCCAGG + Intronic
1172914000 20:38430332-38430354 TAAAAATAAAAAAATAGGCCGGG + Intergenic
1173017698 20:39240846-39240868 TAAAATTCAGAGTGAAGGCCAGG + Intergenic
1173510939 20:43627865-43627887 TAAAAATAAAAGCGAAGGCCAGG - Intronic
1173541117 20:43852224-43852246 TTAAAACCATTGAGGAGGCCGGG - Intergenic
1173685811 20:44922664-44922686 GAAAAATCTTAGAGGGGGCCAGG - Intronic
1173740416 20:45396246-45396268 AAAAAATAATAAAATAGGCCGGG - Intronic
1173808552 20:45941880-45941902 TAAAAATTAAAAACTAGGCCAGG - Intronic
1174329595 20:49807650-49807672 AAAAAATCATAGTTTTGGCCGGG - Intergenic
1174461142 20:50683782-50683804 TTAAAATTCTAGAGGAGGCCGGG + Intronic
1174614007 20:51822035-51822057 TAAAAATAAAAAATTAGGCCAGG - Intergenic
1174639378 20:52030027-52030049 TAAATATAATAAAATAGGCCAGG + Intergenic
1174810069 20:53637926-53637948 TAAAAACCAGAGAGTAGGCTGGG - Intergenic
1175111231 20:56649505-56649527 AAAAAAGCACAGTGTAGGCCAGG - Intergenic
1175137460 20:56835206-56835228 GAAACATCATAGAGAAAGCCAGG + Intergenic
1175163532 20:57026668-57026690 TAAAGAACATAGAACAGGCCGGG - Intergenic
1175436129 20:58950474-58950496 TGAAAATCAAAGCATAGGCCAGG + Intergenic
1175526181 20:59635527-59635549 TAAAAAGCAAGGAGCAGGCCGGG - Intronic
1175647463 20:60687019-60687041 TAAAAATCGAAGAGTTGGCCGGG + Intergenic
1176722380 21:10402892-10402914 TAAAAATAAAAAACTAGGCCGGG - Intergenic
1176766113 21:13020167-13020189 TAAAAAGAATAGAGTAAGCCGGG + Intergenic
1177000807 21:15610478-15610500 TAAAAATGAGAGAGGATGCCGGG + Intergenic
1177481565 21:21696590-21696612 TAAAAATAATATTGCAGGCCGGG - Intergenic
1177494734 21:21873803-21873825 TTAAAACCAAATAGTAGGCCTGG + Intergenic
1177523594 21:22264033-22264055 TGAAAAGCACAGTGTAGGCCAGG + Intergenic
1177590822 21:23164726-23164748 TAAAAAACATAAAATAGGCTGGG + Intergenic
1177708514 21:24740155-24740177 TAAAAAGCATAGAGACGCCCAGG + Intergenic
1177827695 21:26102382-26102404 TAAAAACCATAGTTTTGGCCGGG - Intronic
1178094621 21:29200053-29200075 TAAAAGTCTTAGAAGAGGCCGGG - Intronic
1178257134 21:31064356-31064378 TAAAAATCATAGCCTGGGCTGGG - Intergenic
1178265045 21:31134804-31134826 TAAAAATAACAAAGGAGGCCAGG - Intronic
1178419741 21:32433997-32434019 AAAAAATAATAAAATAGGCCAGG + Intronic
1178520167 21:33282820-33282842 TAAAAAAGATAAAGCAGGCCGGG - Intronic
1178596314 21:33956692-33956714 CAACAATCAGAGAATAGGCCGGG + Intergenic
1178614450 21:34118808-34118830 TAAGAAACATGGAGTAGGCTGGG - Intronic
1178720294 21:35002721-35002743 TAAAAATAAATAAGTAGGCCGGG - Intronic
1178751372 21:35307116-35307138 TAAAAATGTTAGTGTTGGCCGGG + Intronic
1179476065 21:41646053-41646075 TAAAAAGTATAGAGCAGGCCAGG - Intergenic
1180133084 21:45840155-45840177 TAAAAATGTTACAGTAGGCTGGG + Intronic
1180303563 22:11055654-11055676 TAAAAATAAAAAACTAGGCCGGG - Intergenic
1180620809 22:17160352-17160374 TAAAAATAATAAAATAGGGCCGG + Intronic
1180822036 22:18836869-18836891 TAAAATTCAAAAATTAGGCCAGG + Intergenic
1180917943 22:19502010-19502032 TAAAAATGATTAAGAAGGCCAGG - Intronic
1181190940 22:21139177-21139199 TAAAATTCAAAAATTAGGCCAGG - Intergenic
1181208264 22:21271330-21271352 TAAAATTCAAAAATTAGGCCAGG + Intergenic
1181645417 22:24228795-24228817 TAAAAATGATATAATGGGCCAGG + Intronic
1181660324 22:24342373-24342395 GAAAAAGAATAGAGGAGGCCAGG + Intronic
1181676640 22:24458491-24458513 TAAAAATAGTGGATTAGGCCAGG + Intergenic
1182105185 22:27684049-27684071 TAAAAATAATAAAATAGGCCGGG + Intergenic
1182177853 22:28311072-28311094 TAAGAATATTAAAGTAGGCCAGG - Intronic
1182388219 22:29965400-29965422 TTAAAAAATTAGAGTAGGCCAGG + Intronic
1182389596 22:29981536-29981558 TAAAAAGCCCAGGGTAGGCCGGG + Intronic
1182553391 22:31114669-31114691 TAAAAATAATAGGCTTGGCCGGG + Intronic
1182568512 22:31217939-31217961 TACAAGGCACAGAGTAGGCCAGG - Intronic
1182595329 22:31415649-31415671 GAAAAAATAAAGAGTAGGCCAGG - Intronic
1182602266 22:31475454-31475476 TAAAATTCATCGAGTGGGCCGGG + Intronic
1182638018 22:31744426-31744448 CAAAAATAAAAAAGTAGGCCGGG - Intronic
1182644414 22:31796394-31796416 AAAAAATGATACAGTGGGCCAGG - Intronic
1182709728 22:32313057-32313079 AAAAAAGCATAGACTAGGACTGG + Intergenic
1183076137 22:35428315-35428337 AAAAAATAATAAAATAGGCCAGG - Intergenic
1183251946 22:36736514-36736536 GAAAAATCACAGAGTGGGCCAGG - Intergenic
1183330384 22:37217094-37217116 TCAAAATGAGAGAGGAGGCCAGG - Intergenic
1183571811 22:38658769-38658791 TGAAAATAAAAGAATAGGCCGGG - Intronic
1183763603 22:39848545-39848567 TTAAAAGCAGAGAGTTGGCCGGG - Intronic
1183840882 22:40500222-40500244 AAAAAATCATAGACTGGGCCGGG - Intronic
1183915979 22:41119589-41119611 TATAAATTTTAGAGTATGCCAGG + Intronic
1183962055 22:41417269-41417291 AAAAAATCACAGTGTTGGCCGGG + Intergenic
1184700379 22:46167745-46167767 TAAAAAGCATTAACTAGGCCAGG + Intronic
1184883564 22:47328044-47328066 TAAAATGCATAGAGATGGCCGGG + Intergenic
1185075769 22:48681345-48681367 TAAAAACCAGAGATGAGGCCGGG + Intronic
1185293947 22:50044027-50044049 TTAAAATCATTAATTAGGCCAGG + Intronic
1203218664 22_KI270731v1_random:24082-24104 TAAAATTCAAAAATTAGGCCAGG - Intergenic
1203272165 22_KI270734v1_random:62754-62776 TAAAATTCAAAAATTAGGCCAGG + Intergenic
949107541 3:218849-218871 GAAAAGTCAAAAAGTAGGCCGGG + Intronic
949691345 3:6643522-6643544 TAAAAATAGTAGAGTAGGCCAGG + Intergenic
950373422 3:12550501-12550523 CAAAACCCATAGAGTAAGCCTGG + Intronic
951047516 3:18056925-18056947 TAAAAATCACAGTGTGGGCCAGG - Intronic
951532474 3:23710702-23710724 TAAACATCAGTGAGTAGGGCAGG - Intergenic
951714191 3:25621652-25621674 TAAGAATTTTAGAGTAGGCCAGG - Intronic
951872463 3:27380011-27380033 TTAAAAGAACAGAGTAGGCCGGG + Intronic
952055192 3:29435641-29435663 TAAGAATCATAGACCTGGCCGGG + Intronic
952069594 3:29618197-29618219 AAAATAGCACAGAGTAGGCCGGG + Intronic
952292446 3:32030868-32030890 TGAAAATAATTGAGGAGGCCGGG + Intronic
952364318 3:32661530-32661552 TAAAAATAAAAAAATAGGCCAGG + Intergenic
952582796 3:34854152-34854174 TTAAAATAATAAAATAGGCCGGG - Intergenic
953028632 3:39161253-39161275 TCAAAAGCACAGAATAGGCCGGG + Intergenic
953739945 3:45529162-45529184 TAAAAATGATGTTGTAGGCCGGG - Intronic
954159749 3:48712539-48712561 TAAAAATTTTATTGTAGGCCGGG - Intronic
954178587 3:48863719-48863741 AAAAAATAATAGAAAAGGCCGGG + Intronic
954179701 3:48872122-48872144 AAAAAATCATTGGGCAGGCCAGG - Intronic
954209577 3:49087578-49087600 TAAAAATAAAAAAATAGGCCAGG + Intronic
954312386 3:49779981-49780003 TAAAAATCTAGGTGTAGGCCAGG - Intronic
954393870 3:50282146-50282168 AAAAAATCAAAGATTAGGGCCGG - Intronic
954721693 3:52569503-52569525 TAAAAATCATATTGAAGGCCGGG - Intronic
955172739 3:56583160-56583182 TAAAAGTCAGAAAGTTGGCCAGG - Intronic
955365869 3:58309594-58309616 TAAAAACCAAACAGGAGGCCAGG + Intronic
955369328 3:58337628-58337650 TAAAAATCAAAGAATTAGCCAGG - Intronic
955574738 3:60348052-60348074 TTAAAATGAAAGGGTAGGCCAGG - Intronic
955580616 3:60416789-60416811 TAAAAATCTGAGAACAGGCCGGG + Intronic
955727824 3:61951822-61951844 TAAAAATGATAGAATCGGCCTGG + Intronic
955734347 3:62020968-62020990 TAAAAAACATAGATGAGGCCAGG - Intronic
955791675 3:62594454-62594476 TAAAAATCATAATGAGGGCCGGG - Intronic
955808740 3:62763449-62763471 TAAAAGTCCAGGAGTAGGCCTGG - Intronic
955810525 3:62783053-62783075 AAAAAATGCTAGACTAGGCCAGG - Intronic
956040436 3:65139639-65139661 TACAAATTATAGGGTAGGTCAGG + Intergenic
956111755 3:65877036-65877058 TAAAAATTAGAGCATAGGCCAGG - Intronic
956308284 3:67850511-67850533 TAAAAATAAAATAGTTGGCCGGG - Intergenic
956402724 3:68897195-68897217 GAAAAACAATAGATTAGGCCAGG - Intronic
956706078 3:72000421-72000443 TAAGAAGCACAGACTAGGCCAGG - Intergenic
956791077 3:72680558-72680580 CAAAACTCACAGAGTAGTCCTGG - Intergenic
957110407 3:75948318-75948340 TAAAAAGTGTAGAGTAGGGCTGG + Intronic
957128572 3:76194911-76194933 AAAAAATCATACTATAGGCCTGG - Intronic
957333749 3:78799635-78799657 CAAAAATGGTAGAGTAGGGCCGG - Intronic
957642233 3:82869993-82870015 TTAAAAACATTGAGAAGGCCGGG + Intergenic
958439292 3:94135816-94135838 TAAAAATCTTAGGTGAGGCCGGG - Intergenic
958603173 3:96325681-96325703 TAAAAATGAAAGAGGAGGCCAGG + Intergenic
959962736 3:112317970-112317992 TAAAAATAATAGATAAGGCCTGG - Intergenic
959974075 3:112438161-112438183 TAAAAAGCATAGAGTGGGCCAGG + Intergenic
960026312 3:113014646-113014668 TAAAAATCATGTTGTCGGCCAGG - Intronic
960035013 3:113093374-113093396 GAAAGATGACAGAGTAGGCCAGG - Intergenic
960217867 3:115064746-115064768 TAAAATTCAGAGAGAAGGCCGGG - Intronic
960383334 3:116991219-116991241 AAAAATACATAAAGTAGGCCGGG + Intronic
960432938 3:117591868-117591890 TAAAAATCATCTAGGAGGTCAGG - Intergenic
960436702 3:117635020-117635042 TAAAAATCATAGATGAGGCCAGG - Intergenic
960548672 3:118948668-118948690 TAAAAAGCAAACATTAGGCCGGG + Intronic
960620358 3:119631104-119631126 TGAAAATCATATTGTCGGCCGGG + Intergenic
960824857 3:121771883-121771905 TAAAAATTATAGGCTAGGCACGG + Intronic
960980560 3:123221173-123221195 TAAAAATTACTGTGTAGGCCGGG + Intronic
961052954 3:123762525-123762547 TAAAAAGAATAAAGTAGGCCAGG - Intronic
961316926 3:126044598-126044620 TTAAAATCATACAGAGGGCCGGG + Intronic
961342864 3:126240828-126240850 TAAAAATAAAAGATGAGGCCAGG + Intergenic
961534017 3:127558320-127558342 TAAAAATGCTGGAGGAGGCCGGG + Intergenic
961747595 3:129075051-129075073 TAAAAATGACTAAGTAGGCCAGG - Intergenic
961852301 3:129833281-129833303 TAAAAATCCTATCTTAGGCCAGG + Intronic
962286639 3:134091818-134091840 TAAAAGTTTTAAAGTAGGCCAGG - Intronic
962333923 3:134508424-134508446 TAAAAATCATAATTTAGGCAGGG + Intronic
962587177 3:136853392-136853414 TAAAAATGACAGTGTAGGCACGG - Intronic
963104779 3:141637694-141637716 AAAAAATCAGAGACAAGGCCAGG - Intergenic
963185200 3:142407622-142407644 TAAAAACAAAAAAGTAGGCCGGG - Intronic
963195412 3:142523124-142523146 TAAAAAGCAAAATGTAGGCCAGG + Intronic
964218980 3:154323037-154323059 TAAAAATAGTAGTCTAGGCCTGG + Intronic
964531748 3:157675300-157675322 TAACAAATATACAGTAGGCCTGG - Intronic
964562843 3:158017449-158017471 TAAAAGTCCTAGAATAGTCCTGG - Intergenic
964634076 3:158841898-158841920 TAAAGATGATACTGTAGGCCAGG + Intergenic
964827040 3:160839968-160839990 TAAAAGTCATGGAGTAGGGAGGG + Intronic
965188246 3:165493551-165493573 TAAAAATCTTAGGGTAAGCAAGG + Intergenic
965202031 3:165671896-165671918 TAAAAAGCAGAAAGTAGGCATGG - Intergenic
965354138 3:167653118-167653140 TAAAAATAATTGGTTAGGCCTGG - Intronic
965584054 3:170299520-170299542 TATAAATTATAGTATAGGCCGGG - Intronic
965804340 3:172526649-172526671 TAAAAATTATAAAACAGGCCGGG - Intergenic
965920063 3:173902683-173902705 AGAGAATCATAGAGTAGGCATGG + Intronic
965921314 3:173918339-173918361 TAAAATGCATAGAATGGGCCGGG + Intronic
966211207 3:177455192-177455214 AAATAATCATAAAATAGGCCAGG + Intergenic
966222607 3:177565690-177565712 CAAGAATCCTAGAGGAGGCCGGG - Intergenic
966392832 3:179470882-179470904 TAAAAAAGTTACAGTAGGCCGGG + Intergenic
966601542 3:181780220-181780242 TTAAAAGCATAGATTAGGCCTGG + Intergenic
966790949 3:183668911-183668933 AAAAAATCTTAGAGTAGGAAGGG + Intronic
967008343 3:185406927-185406949 CAGAAATCATAGAGTGGGGCTGG + Intronic
967008719 3:185410637-185410659 TAAAAATTAAAAAATAGGCCAGG + Intronic
967112998 3:186311819-186311841 TTAAGAACACAGAGTAGGCCGGG + Intronic
967557463 3:190876359-190876381 TAAAATTCCTAGTGTTGGCCGGG - Intronic
967744788 3:193043025-193043047 TAAAAATGAGAGAGAAGGCCAGG - Intergenic
967790425 3:193542868-193542890 TAAAAAACCTAGAAGAGGCCAGG + Intronic
967974249 3:195023097-195023119 TAAAAATGATAAAATAGGCCGGG - Intergenic
968216326 3:196894416-196894438 TAAAAATAACACATTAGGCCGGG - Intronic
968348276 3:198030137-198030159 TAAAAATAAAAAAGCAGGCCAGG - Intronic
968429508 4:547777-547799 TAAAGATCATTTAGTTGGCCAGG - Intergenic
969175903 4:5398955-5398977 TAAAAATCAGAGGTCAGGCCCGG + Intronic
969434268 4:7176299-7176321 AAAAACTCATAGGATAGGCCAGG - Intergenic
969558286 4:7928679-7928701 TAAAACTGGTAAAGTAGGCCAGG - Intronic
970109996 4:12627176-12627198 TAAAAATCCTAGAAGAGGCCAGG - Intergenic
970113640 4:12668365-12668387 TAAAAATTATAAATGAGGCCAGG - Intergenic
971252670 4:24986274-24986296 AGAAAATCATATAGAAGGCCGGG - Intergenic
971338534 4:25746220-25746242 AAAAAAGCATATAATAGGCCAGG + Intergenic
971583761 4:28377834-28377856 TAAAAATATTAGAGTATTCCAGG + Intronic
971840060 4:31839561-31839583 TAATAATCACATAGTAGGACAGG - Intergenic
972112653 4:35584744-35584766 TAAAAATCAAATAGAGGGCCGGG + Intergenic
972271689 4:37516959-37516981 TAAAAATTATACAGTAGGCCAGG + Intronic
972415372 4:38833929-38833951 TACAAACAATAGACTAGGCCAGG + Intronic
972589174 4:40467988-40468010 AAAAAATAATAAAGGAGGCCAGG + Intronic
972893994 4:43596400-43596422 TAAAATTCTAAGAGCAGGCCGGG + Intergenic
974006903 4:56566988-56567010 TAAGAATCTTACACTAGGCCAGG - Intronic
974443509 4:61949400-61949422 TTAAAATCTTAAAATAGGCCGGG + Intronic
974592478 4:63971738-63971760 TAAAAATCCTAGAGTTGGCCTGG - Intergenic
974804030 4:66857165-66857187 TAGAAATAAAAGAGTTGGCCGGG + Intergenic
975405706 4:73986949-73986971 TAATAACCATAAAGTAGACCAGG + Intergenic
975599447 4:76084028-76084050 AAAAAATCATAGAATAACCCTGG - Intronic
975606456 4:76159426-76159448 TAAGAATCATAAAACAGGCCAGG + Exonic
975785054 4:77878582-77878604 TAAAAATCTTATTTTAGGCCAGG + Intronic
975785400 4:77882282-77882304 AAAAAATAATAGAGTTAGCCAGG - Intronic
975888543 4:78995740-78995762 GAAGAACCATAGAGTAGACCTGG - Intergenic
975899752 4:79138304-79138326 TAAAAATTAAAAAATAGGCCAGG + Intergenic
975901562 4:79159426-79159448 AAAAAATAATAGAGTTGGCTTGG + Intergenic
976006181 4:80432815-80432837 TAAAAAATAGAGTGTAGGCCGGG - Intronic
976291883 4:83427357-83427379 TAAAAAGCATATAATAGGCCGGG + Intronic
976531973 4:86165694-86165716 TAAAACTCATATATAAGGCCAGG - Intronic
976589210 4:86832307-86832329 TAAGAATCATAGTGTTGGCCAGG + Intronic
977093074 4:92703978-92704000 TAAAAATAAGAGAATTGGCCGGG + Intronic
977147212 4:93458891-93458913 AGAAATTGATAGAGTAGGCCTGG + Intronic
977495242 4:97767870-97767892 GATAAAACATAGAGTTGGCCAGG + Intronic
977562169 4:98543713-98543735 TAAAAATTCTAAAGTAGGCTGGG - Intronic
977734419 4:100396016-100396038 TAAAAAACTTACAGTAAGCCAGG + Exonic
977933003 4:102768678-102768700 TAAAAATTCTAGAAGAGGCCAGG + Intergenic
978451567 4:108839943-108839965 TTAAAATCCAAGAGTAGGGCCGG + Intronic
978746012 4:112195065-112195087 TAAAAATTAAAATGTAGGCCGGG - Exonic
978785170 4:112601113-112601135 AAAAAATGATAAACTAGGCCAGG + Intronic
978800242 4:112749193-112749215 TTAAAATCATAGGTCAGGCCAGG - Intergenic
978925124 4:114233533-114233555 TAAAAAAGATAGAGGGGGCCAGG + Intergenic
979040087 4:115779137-115779159 TGAAAATCTTAGGGTAGTCCAGG + Intergenic
979143681 4:117212668-117212690 AAAAAATTATAAAGGAGGCCGGG - Intergenic
979250510 4:118562358-118562380 TAAAAACCATTGAATTGGCCAGG + Intergenic
979321911 4:119334816-119334838 TAAAAAGAATACAGTAGGCCAGG + Intergenic
979795937 4:124846833-124846855 TAAAAATGATAGAGCAGGAAAGG - Intergenic
979959566 4:127001379-127001401 TAGAAATCACATAGTAGGCCAGG + Intergenic
980677729 4:136110779-136110801 TAAAAATCTTAAATTTGGCCTGG - Intergenic
980921621 4:139092064-139092086 TAAAAATAATAAAATAGGCCGGG + Intronic
980931883 4:139189772-139189794 TCAAAATTATAAAGTAGGCTGGG - Intergenic
980932835 4:139197916-139197938 TTAAAATCATAAAGTAGGCCAGG + Intergenic
980980192 4:139648381-139648403 AAAACCTCATGGAGTAGGCCGGG + Intergenic
981211514 4:142111641-142111663 TAAAGATCATAGAACAGGCCAGG - Intronic
981308469 4:143271102-143271124 TAAAAATAAGTAAGTAGGCCAGG - Intergenic
981352494 4:143748483-143748505 TAAAAATTAAATAATAGGCCGGG - Intergenic
981523516 4:145689907-145689929 TAAAAATCCTAGAAGAGGCTGGG + Intronic
981660390 4:147159468-147159490 TAAAAATAAAATATTAGGCCGGG + Intergenic
981792377 4:148553064-148553086 AAAAAATAAAAAAGTAGGCCAGG + Intergenic
981946525 4:150351392-150351414 TTAAAAGTATACAGTAGGCCGGG + Intronic
982020727 4:151201713-151201735 AAAAAATAATAAAATAGGCCGGG + Intronic
982247091 4:153363936-153363958 TCAAAAACACAGAGAAGGCCAGG + Intronic
982255337 4:153445822-153445844 AAAAAATTATAGACTAGGCCGGG + Intergenic
982537228 4:156621857-156621879 TAAAAAGGAAAGAGTGGGCCCGG + Intergenic
982643325 4:157990281-157990303 TAAGAATCAAAGAATAGGCCAGG + Intergenic
982825247 4:159996321-159996343 TAAAAATGATAAAGGAGGCCGGG + Intergenic
982978512 4:162100263-162100285 GAAAACACATAGAGGAGGCCGGG + Intronic
982999955 4:162401951-162401973 TAAAAATTATACAGGCGGCCGGG + Intergenic
983014437 4:162594266-162594288 AAAAAATTATGGAGAAGGCCAGG + Intergenic
983120060 4:163872747-163872769 TAAAAATGATGAAGTCGGCCGGG + Intronic
983121987 4:163897759-163897781 TAAAAATCCTTGAAGAGGCCAGG + Intronic
983239887 4:165220422-165220444 TAAAAAGAATACAGTAGGCCAGG + Intronic
983365833 4:166787884-166787906 TAAAAAACATAAATTTGGCCAGG + Intronic
983763851 4:171451514-171451536 TAGAAAACATTGATTAGGCCGGG + Intergenic
983877647 4:172895948-172895970 TAAAAATCACAGAGAAATCCTGG - Intronic
983903093 4:173157815-173157837 TAAAAATAAAAGAATAGGCTGGG + Intergenic
984020409 4:174478342-174478364 TAAAAATCATAGGCCAGGCACGG + Intergenic
984415339 4:179450356-179450378 AAAGAATCATAGACTAGGGCTGG - Intergenic
984684519 4:182651393-182651415 TGAAAATCAGAGTTTAGGCCGGG + Intronic
984780548 4:183522189-183522211 TAAAAATGACAGTATAGGCCAGG + Intergenic
984927014 4:184815823-184815845 TAAAAAGCAGAGATGAGGCCAGG + Intronic
984967714 4:185155102-185155124 TAAAAATCCCAGAAGAGGCCAGG + Intergenic
985200053 4:187475636-187475658 TAAAAAACACATAGAAGGCCGGG + Intergenic
985294367 4:188419341-188419363 TAAAAATGACAAAATAGGCCGGG + Intergenic
985413908 4:189717503-189717525 TAAAAATCTTACAGCAGTCCTGG - Intergenic
1202769216 4_GL000008v2_random:185986-186008 TAAAACTCAGAAAGTAGGCTGGG + Intergenic
985696349 5:1342895-1342917 TAAAAATCTTACGGTTGGCCGGG + Intronic
985983880 5:3497131-3497153 TAAAAATCTTAAAATTGGCCAGG + Intergenic
986891711 5:12317140-12317162 TAAAAACCAGAGAGTGGGCTTGG - Intergenic
987015142 5:13810443-13810465 TAAACATAATAGGGTTGGCCGGG + Intronic
987205205 5:15618445-15618467 TAAAAAACATAGAATAGGTGTGG + Intronic
987393336 5:17397574-17397596 TTAAAATCAATGAGTTGGCCGGG - Intergenic
987446740 5:18029791-18029813 TAAAAATGACACATTAGGCCAGG + Intergenic
987512692 5:18860799-18860821 TAAAAAGCAAAGTGTAGGCCAGG + Intergenic
987595433 5:19991706-19991728 TAAGAATTACAGAGTAGGACAGG + Intronic
987679331 5:21115628-21115650 TAAAAATCCAAGAATAGGCCAGG + Intergenic
987787751 5:22524280-22524302 TAAAAATTATAAATGAGGCCAGG - Intronic
987832413 5:23112386-23112408 TATAAATCATAAAGAAAGCCAGG + Intergenic
988039500 5:25871473-25871495 TAAAAAGTTTACAGTAGGCCAGG + Intergenic
988049861 5:26013536-26013558 TAAGAATAATAGTTTAGGCCAGG - Intergenic
988098624 5:26649963-26649985 TTATAATCAGAGAGAAGGCCTGG - Intergenic
988546803 5:32165285-32165307 AAAAAATTATAGAACAGGCCAGG + Intronic
989040996 5:37229256-37229278 TAAATATAATCGAGGAGGCCGGG + Intronic
989184655 5:38611882-38611904 TAAAAATTATAATTTAGGCCGGG + Intergenic
989187218 5:38637247-38637269 CAAAAATCAGAGTGTGGGCCGGG + Intergenic
989509766 5:42271909-42271931 TCAAAAAGAGAGAGTAGGCCGGG - Intergenic
989624802 5:43419131-43419153 TAAAAATCATGTTTTAGGCCAGG - Intergenic
989808388 5:45640824-45640846 TAAAAATCATAGTTAAGGCTGGG - Intronic
990073898 5:51819159-51819181 TAAAAAACAAAGTTTAGGCCGGG + Intergenic
990087222 5:51993755-51993777 AATAAATCTTAGAGTAGGCTGGG + Intergenic
990309240 5:54521861-54521883 TAAAAAAGATAAACTAGGCCGGG - Intronic
990621306 5:57562307-57562329 AAAAAATCAGAGAGGAGTCCTGG - Intergenic
990960047 5:61384760-61384782 TAAAAATCTTGGAGGAGGCCGGG + Intronic
990963405 5:61418552-61418574 TAAAAATCATAGAGTAGGCCGGG - Intronic
991387263 5:66104079-66104101 TAAAATTGATAGACCAGGCCAGG + Intergenic
991774948 5:70075507-70075529 TAAAAATACAAGACTAGGCCGGG - Intronic
991854241 5:70950932-70950954 TAAAAATACAAGACTAGGCCGGG - Intronic
992019145 5:72605353-72605375 TAAGAATGAGAGAGTAGGCGCGG + Intergenic
992220699 5:74569382-74569404 TAAAAATCCTACAAGAGGCCGGG - Intergenic
992632161 5:78692102-78692124 TAAAAATAGTACATTAGGCCAGG + Intronic
992723445 5:79582892-79582914 TAAATAACATAGATTTGGCCAGG + Intergenic
992782232 5:80138298-80138320 AAAAATTCTGAGAGTAGGCCGGG + Intronic
992903422 5:81321648-81321670 AAAAAATGATAAAGTGGGCCAGG + Intergenic
992923276 5:81550799-81550821 TAGAAATCATAGAAGAGGCCAGG + Intronic
993055988 5:82980317-82980339 TAAAAGCCATAGAGTGAGCCGGG + Intergenic
993510288 5:88762561-88762583 TAATAATAATAAAGCAGGCCAGG - Intronic
993512105 5:88783331-88783353 TAAGAAACAGAGAGTTGGCCGGG + Intronic
994114317 5:96045055-96045077 GAAAATTCATAGAGCTGGCCGGG + Intergenic
994401201 5:99281793-99281815 TAAATATCAGAGAGTAGGGATGG + Intergenic
994569809 5:101502182-101502204 AGAAAATCATTGAGTGGGCCAGG + Intergenic
994848809 5:105026112-105026134 TAAGAATAAAAGAATAGGCCAGG + Intergenic
995089575 5:108158067-108158089 TAAAAATCCTAGAGAAGACTGGG + Intronic
995122248 5:108548682-108548704 TAAAATGCATAGATGAGGCCAGG + Intergenic
995399299 5:111722154-111722176 TAAAAATGATAGCTGAGGCCTGG - Intronic
995474894 5:112538071-112538093 CAAAAATCATAGAATAGTGCAGG + Intergenic
995596275 5:113752137-113752159 TTAGAGTCATAGAGTAGGTCAGG + Intergenic
995669924 5:114591042-114591064 TAAAAATCATAGAGAACGTAGGG - Intergenic
996049463 5:118915667-118915689 TAAATTTCAAAGATTAGGCCGGG - Intronic
996070769 5:119128768-119128790 AAAAAATCTTAAAATAGGCCAGG + Intronic
996380068 5:122854211-122854233 AAATAATCATAGTGTAGGCCGGG + Intronic
997062101 5:130518667-130518689 TAAAAGGCATAGAGTGGGCTGGG - Intergenic
997311702 5:132890427-132890449 TATAAAACATAGAGGGGGCCAGG - Intronic
997326033 5:133022089-133022111 TATAAGTTATAAAGTAGGCCGGG - Intronic
997494480 5:134310483-134310505 AAAAAATAAAAGAATAGGCCGGG - Intronic
997722657 5:136092088-136092110 TAAAAATAATAGAACAGGCCGGG - Intergenic
997722711 5:136092523-136092545 TAAAAATAATAGAACAGGCCGGG - Intergenic
997818614 5:137042462-137042484 AAAAAATCATTTAGGAGGCCAGG + Intronic
997954982 5:138272342-138272364 TAAAAATCAGATTTTAGGCCGGG + Intronic
998842365 5:146268535-146268557 TAGAAATGATAGAGTAGGCCGGG - Intronic
999459861 5:151748564-151748586 TAAAAATCATATGGTTGGCCAGG + Intronic
999533398 5:152488197-152488219 TTAAAGATATAGAGTAGGCCAGG + Intergenic
999686561 5:154108338-154108360 TAAGAATGATAGTGTAGGCCGGG + Intronic
999707854 5:154290402-154290424 TTAAAATTATAGAGTTGGTCAGG - Intronic
999782806 5:154864163-154864185 TAGAAATTATAGAGTTGGCCGGG + Intronic
999875092 5:155796506-155796528 TAAAAATCAATGATTCGGCCGGG + Intergenic
999911924 5:156210622-156210644 TAAAAATCAAACAGAAGTCCTGG + Intronic
1000011758 5:157239747-157239769 TTAAATTCATAGAATAGGCAAGG + Intronic
1000192444 5:158924555-158924577 TAAAAATGATAAACTGGGCCGGG + Intronic
1000309230 5:160025320-160025342 TAAAAAACAAAAATTAGGCCAGG - Intronic
1000391251 5:160725738-160725760 TAAGAATCCCATAGTAGGCCGGG - Intronic
1000687849 5:164274797-164274819 AAAAAATAAAAAAGTAGGCCGGG + Intergenic
1000752313 5:165112412-165112434 AGAAAATCATTGAGGAGGCCAGG + Intergenic
1000820984 5:165982961-165982983 TAAAAATTTAAGAATAGGCCAGG - Intergenic
1000914212 5:167060355-167060377 TAAAAAGCAAAAAGAAGGCCAGG + Intergenic
1001107461 5:168867261-168867283 GAAAAATTCTAGAGTAGGCCGGG + Intronic
1001296540 5:170503092-170503114 GAAAAATGAGAGAGCAGGCCGGG + Intronic
1001391418 5:171382345-171382367 TATAAATTATAGAGCAGGCTAGG - Intergenic
1001448019 5:171801740-171801762 TAAAAACAATAAAATAGGCCAGG + Intergenic
1001464214 5:171947938-171947960 TAAAAATAAAAATGTAGGCCAGG + Intronic
1001868048 5:175122832-175122854 TAAATATCATTGTGTTGGCCAGG + Intergenic
1002143135 5:177157070-177157092 TAAAAATCAAAGTATAGGCCGGG + Intronic
1002490604 5:179573815-179573837 AAAAAATCACAAAGTAGGCCGGG - Intronic
1002627760 5:180543352-180543374 AAAAAATCAGAGTGCAGGCCGGG - Intronic
1002669695 5:180856657-180856679 TAAAAATGACAGAGGCGGCCGGG + Intronic
1002684699 5:181000509-181000531 TTAAAATCATAACATAGGCCGGG + Intronic
1002687674 5:181027135-181027157 TAAAAGATATAGAGTGGGCCGGG + Intergenic
1002711221 5:181196084-181196106 TTAAAATAATACAGTAGGCCAGG + Intronic
1002867436 6:1134407-1134429 TAAAAATTTGAAAGTAGGCCGGG - Intergenic
1003323056 6:5069772-5069794 TAAAATACATAGTGTAGGCCGGG - Intergenic
1003582878 6:7358543-7358565 TAAACATCTAGGAGTAGGCCAGG + Intronic
1003601685 6:7523592-7523614 TAAAAAACAAAGATGAGGCCAGG + Intergenic
1003664776 6:8100928-8100950 TAAAAAATATAAACTAGGCCAGG + Intronic
1003799943 6:9652569-9652591 TAAAAAACATTGACTAAGCCAGG - Intronic
1003889752 6:10553596-10553618 AAAAAATCATTAAATAGGCCGGG + Intronic
1004509533 6:16274107-16274129 CAAAAATCTTAGAGGAGGCTGGG - Intronic
1004541913 6:16558664-16558686 TAAAAATAATAGTTTTGGCCAGG - Intronic
1004625542 6:17372902-17372924 TAAAAATTATAAATGAGGCCAGG - Intergenic
1004633966 6:17449055-17449077 TAAAAATGATGACGTAGGCCGGG - Intronic
1004649463 6:17594690-17594712 AAAAAATAACAGAGTAGGCTGGG - Intergenic
1004742169 6:18472703-18472725 TAAAAATCAAGGTGTTGGCCAGG + Intergenic
1004928127 6:20435455-20435477 TAAAACTCATTGACTTGGCCGGG + Intronic
1006085690 6:31593242-31593264 TAGAAATCTTGGAGTAGCCCTGG - Intergenic
1006328317 6:33371079-33371101 TAAAAATAAAAAAGCAGGCCAGG + Intergenic
1006475843 6:34253174-34253196 TAAAAATCAAAAAGTAGGCTGGG + Intergenic
1006486593 6:34348001-34348023 TAAAAATAAAAAATTAGGCCAGG + Intronic
1006531795 6:34661828-34661850 TAAAAGACATAGAAGAGGCCAGG + Intronic
1006622249 6:35373963-35373985 CAAGAAACATACAGTAGGCCAGG - Intronic
1006658283 6:35616015-35616037 TCAAAATAGTAGAGTAGGCTGGG + Intronic
1006714964 6:36111909-36111931 TAAGAATCAGACAGTTGGCCGGG + Intergenic
1006718464 6:36135138-36135160 TAAAAATTATAAAATAGGCCAGG - Intronic
1006720849 6:36149638-36149660 TGAAATTCATAGAGCAGGCCAGG + Intergenic
1006830619 6:36965706-36965728 GAAAAAACATAGAGTAGACCGGG - Intergenic
1007127380 6:39438267-39438289 TAAAAAGTATAGTATAGGCCAGG - Intronic
1007453510 6:41958290-41958312 TAAAAATGAAAAAGTAGGCCAGG - Intronic
1007567108 6:42859938-42859960 TAAATATCAATGAGTAGGCCGGG - Intronic
1007576460 6:42928280-42928302 TAAAAAATAAAGAGGAGGCCGGG - Intergenic
1007626560 6:43249870-43249892 TTAAAATCATAAGGGAGGCCAGG - Intronic
1007805548 6:44442228-44442250 CAAAAGGCATAGAGTAGGCCAGG - Intronic
1007879957 6:45153770-45153792 AAAAAATCAGAGCTTAGGCCGGG + Intronic
1008075510 6:47141308-47141330 TAGAAATCTTAAAGTAGGCTGGG + Intergenic
1008136152 6:47779642-47779664 TAAAAATTATTGTCTAGGCCAGG + Intergenic
1008322928 6:50139904-50139926 GAAAAAACATGGAGGAGGCCCGG - Intergenic
1008500433 6:52175848-52175870 TAAAAATAATACTATAGGCCGGG + Intergenic
1008528997 6:52436935-52436957 TAAAAAACATAAACTATGCCAGG - Intronic
1008747065 6:54684754-54684776 TAAAAAGGATAGATTTGGCCGGG - Intergenic
1008895888 6:56554377-56554399 TAAAAGTCATAGACGTGGCCAGG - Intronic
1009318728 6:62257726-62257748 TAAAACTCTTAAAGTAGGTCAGG - Intronic
1009421924 6:63473175-63473197 AAAAAATCTTTTAGTAGGCCAGG + Intergenic
1009579359 6:65512195-65512217 TAAAAATTACATTGTAGGCCGGG + Intronic
1010152957 6:72757682-72757704 AAAAAATCATAGCGTAACCCTGG + Intronic
1010422656 6:75692322-75692344 TTAAAAGCATAAATTAGGCCAGG + Intronic
1010657960 6:78534798-78534820 TAAAAATGACAGAACAGGCCGGG + Intergenic
1010929215 6:81780264-81780286 TAAAAATCAGTTGGTAGGCCAGG + Intergenic
1011117291 6:83907247-83907269 TAAAAGTCTTAAAATAGGCCAGG - Intronic
1011355139 6:86466134-86466156 AAAAAATAATTTAGTAGGCCAGG + Intergenic
1011440356 6:87380746-87380768 TCAAAAACAAAAAGTAGGCCGGG - Intronic
1012080817 6:94756306-94756328 TAAAAAACATAATTTAGGCCAGG - Intergenic
1012197933 6:96367751-96367773 TAAAAATTGTAGAGCTGGCCGGG - Intergenic
1012458068 6:99429144-99429166 TAAGAATCAAAGAGTAGGCTGGG - Intergenic
1012802300 6:103846678-103846700 TAAAAAACTTAGTGTGGGCCGGG + Intergenic
1012869004 6:104651956-104651978 TCAAATTCAGAGAGAAGGCCAGG + Intergenic
1013006512 6:106079253-106079275 TAAAAATAATAGACCAGGCGCGG - Intergenic
1013133398 6:107256884-107256906 TAACAATAATAGAAGAGGCCAGG + Intronic
1013203232 6:107922216-107922238 TAAATATCAAAAAATAGGCCAGG + Intronic
1013249058 6:108316084-108316106 TAAAAATCGGAAAGTTGGCCGGG + Intronic
1013730870 6:113165461-113165483 TAAAAAGCACACAGTAGGCTGGG + Intergenic
1013820508 6:114148321-114148343 TAAAAACCCTAGAAGAGGCCAGG + Intronic
1013839049 6:114368249-114368271 TAGAAATCAGAAAGTAGGGCAGG - Intergenic
1013899680 6:115139936-115139958 TAAAGATTATAATGTAGGCCGGG + Intergenic
1013953820 6:115817806-115817828 TAAAAATAAAAAAGAAGGCCAGG + Intergenic
1014130116 6:117821420-117821442 TAAAAATTTTAGTTTAGGCCGGG + Intergenic
1014509109 6:122298865-122298887 TAAAGGCCATAGAGTATGCCAGG - Intergenic
1014577368 6:123090114-123090136 TAAAACTCAAAAACTAGGCCGGG - Intergenic
1014657685 6:124128478-124128500 TAAAGTTCTTAGATTAGGCCAGG - Intronic
1014766656 6:125414929-125414951 CACAAATCATAGAGTAATCCAGG + Intergenic
1014984265 6:127982567-127982589 TAAAAGTCAAAAATTAGGCCAGG - Intronic
1015555473 6:134457068-134457090 TAAAAATTATAAAGCTGGCCAGG - Intergenic
1015921983 6:138275453-138275475 TAAAATTCATAGGGATGGCCGGG + Intronic
1015933359 6:138384413-138384435 GAAAAATCACTGAGGAGGCCAGG - Intergenic
1015974813 6:138779061-138779083 TAAAAATGCTTCAGTAGGCCGGG - Intronic
1016223318 6:141703503-141703525 TCAAAATCATGGAGCCGGCCAGG + Intergenic
1016447234 6:144146715-144146737 TAAAAATCAAAGAATTAGCCGGG - Intergenic
1016550019 6:145269245-145269267 TAAAAATCATCTTGTAGACCAGG - Intergenic
1016744368 6:147562525-147562547 TAAAAACCAAAGTGTTGGCCGGG + Intronic
1016894664 6:149040360-149040382 TAAAAATAAAATTGTAGGCCGGG + Intronic
1017353095 6:153467616-153467638 GAAAAAGAATAAAGTAGGCCGGG - Intergenic
1017517157 6:155166614-155166636 TAAAAATGTTAGAAGAGGCCAGG - Intronic
1018249706 6:161856954-161856976 AAAGAATCAGAGAGTAGTCCTGG + Intronic
1018289393 6:162275488-162275510 AAAAAATTATAGAAAAGGCCGGG + Intronic
1018882411 6:167897937-167897959 TAAAAAGCATACAGTTGGCCAGG - Intronic
1018987924 6:168651743-168651765 TAAATTTAATAGAGCAGGCCGGG + Intronic
1019008283 6:168821987-168822009 TAAAAATCACATAGTATGCCAGG - Intergenic
1019221405 6:170476066-170476088 CAAAAATCACATGGTAGGCCGGG + Intergenic
1019756042 7:2770993-2771015 TTAAAATCAAAGAAAAGGCCAGG + Intronic
1019843955 7:3477807-3477829 AAAAAACCATAAAGCAGGCCAGG - Intronic
1020189427 7:5983945-5983967 TAAAAAGAATGAAGTAGGCCAGG - Intronic
1020206150 7:6118237-6118259 AAAAAATCAAAAATTAGGCCAGG + Intronic
1020258307 7:6515164-6515186 TAAAACACACAGAGCAGGCCTGG + Intronic
1020384129 7:7579004-7579026 TAAAAATCAGGGTTTAGGCCAGG - Intronic
1020719339 7:11721815-11721837 TAAAATTCATATAGTATTCCAGG + Intronic
1020855722 7:13419953-13419975 TAAAAATCAAAAAACAGGCCGGG - Intergenic
1020966654 7:14878448-14878470 AAAATATCAAAGAGTTGGCCAGG + Intronic
1021109821 7:16680808-16680830 TAAAAATAAAAAAATAGGCCAGG + Intronic
1021500188 7:21324149-21324171 TAAAAATAGTAAGGTAGGCCAGG - Intergenic
1021531649 7:21653169-21653191 TAAAAAGAATAGATTAGGCTGGG - Intronic
1021553588 7:21897775-21897797 TAAAAATAACAAAGTTGGCCGGG - Intronic
1021803367 7:24330333-24330355 AAAAATTGATAGAGTTGGCCAGG - Intergenic
1022000718 7:26223443-26223465 TAAAAATCATTTTTTAGGCCAGG + Intergenic
1022262472 7:28719764-28719786 TAAAAATAATAGATAAGGCCAGG + Intronic
1022462400 7:30622803-30622825 TATAAACAATAGAGAAGGCCGGG + Intronic
1022657988 7:32338706-32338728 CAAAAACCAAAGAGAAGGCCGGG + Intergenic
1023080564 7:36522540-36522562 TAAAAATCATACAGTATGTCAGG + Intronic
1023403522 7:39808474-39808496 AAAAAATCATCCAGTCGGCCGGG + Intergenic
1023608710 7:41953438-41953460 TAAAAATTAAAAAATAGGCCAGG - Intergenic
1023906520 7:44526251-44526273 TAAAAATGAGGGAGAAGGCCAGG + Intronic
1023959520 7:44914683-44914705 TAAAAATAGTAGAGTGGGCTGGG + Intergenic
1024536065 7:50435493-50435515 TAAAAATAAAAAAATAGGCCGGG + Intergenic
1024886160 7:54145077-54145099 TAAAAATTTTAGATTAGGCCGGG - Intergenic
1025616175 7:63119354-63119376 TAAAATTGAAATAGTAGGCCAGG + Intergenic
1025742338 7:64207691-64207713 CAAGAATCATAGAGCGGGCCAGG + Intronic
1025778704 7:64580673-64580695 TAAAAATTATGTAGTAGGCCAGG - Intergenic
1026073568 7:67144763-67144785 TTAAAAACAAAGAGGAGGCCAGG - Intronic
1026478679 7:70760298-70760320 TAAAAATCTTTTTGTAGGCCGGG - Intronic
1026703317 7:72667417-72667439 TTAAAAACAAAGAGGAGGCCAGG + Intronic
1026834692 7:73630586-73630608 TGAAAATCAAAGGGTAGGCCGGG - Intergenic
1026928849 7:74211750-74211772 TAAAAATAAAAAATTAGGCCAGG - Intronic
1027192450 7:76004704-76004726 AAAAAATAATAAAATAGGCCAGG + Intronic
1027394907 7:77744329-77744351 AAAAAGTCAAACAGTAGGCCAGG - Intronic
1027397565 7:77771803-77771825 TAAGAATCACTGAGGAGGCCGGG - Intronic
1027467287 7:78531505-78531527 TAAAAATCTTAAATAAGGCCAGG - Intronic
1027671134 7:81100817-81100839 TAAAAATAATAAAATAGGCTGGG - Intergenic
1027679679 7:81204714-81204736 TAAAAACCATACATTAGGCCAGG - Intergenic
1027953050 7:84843539-84843561 AAAAAATCACTGAGTTGGCCAGG - Intergenic
1027995392 7:85419287-85419309 TAAAATTGATAGAATTGGCCGGG - Intergenic
1028090451 7:86694227-86694249 TAAAAATCAAAGAGAAAGGCCGG + Intronic
1028474527 7:91238907-91238929 TAAAAATTAAAGTCTAGGCCGGG - Intergenic
1028806578 7:95033307-95033329 TAAAAATAAAAAATTAGGCCAGG - Intronic
1029048153 7:97653409-97653431 TTAAAATGATAAAGCAGGCCAGG - Intergenic
1029066037 7:97849509-97849531 TAAAAGTCATCTACTAGGCCCGG + Intergenic
1029299362 7:99567236-99567258 TTGAAAGCATAGAGTCGGCCAGG + Intronic
1029379795 7:100205534-100205556 TAAAAATCAAATAGAGGGCCAGG + Intronic
1029470110 7:100749042-100749064 TAAAAATAAAAAAATAGGCCAGG + Intronic
1029620326 7:101686414-101686436 TAAAAATCAAAATGTGGGCCTGG - Intergenic
1029624721 7:101713506-101713528 TAAAAATCCTAAATCAGGCCGGG - Intergenic
1029751781 7:102546858-102546880 TAAAAATACTAAAGTTGGCCAGG - Intronic
1029769733 7:102645949-102645971 TAAAAATACTAAAGTTGGCCAGG - Intronic
1029978850 7:104859371-104859393 AAAAAAGCATTAAGTAGGCCAGG + Intronic
1030020505 7:105270702-105270724 TAAAAATGGCAGAGGAGGCCTGG - Intronic
1030233048 7:107227993-107228015 AAAAAATAATAGCCTAGGCCAGG + Intronic
1030426699 7:109387560-109387582 CAAAAACCATAGTGCAGGCCTGG + Intergenic
1030431372 7:109453044-109453066 CAAAAATCACAGAATGGGCCAGG - Intergenic
1030608222 7:111661090-111661112 CAAAAAACATGGAGTTGGCCTGG + Intergenic
1030651980 7:112126094-112126116 TAATAAGAATAGTGTAGGCCAGG - Intronic
1030660122 7:112208972-112208994 TAAAAATCAAATCATAGGCCGGG - Intronic
1030785976 7:113662282-113662304 TAAAATTCTTAAAATAGGCCAGG + Intergenic
1031595964 7:123649518-123649540 ATAAAATCCTATAGTAGGCCAGG + Intergenic
1032140288 7:129322889-129322911 TAAAAATAAGAAAATAGGCCAGG - Intronic
1032314239 7:130819963-130819985 TAAAAAAGCTAGAGTGGGCCGGG - Intergenic
1032827934 7:135590407-135590429 TAAAAATAATATAGCAGGCTGGG - Intronic
1033065420 7:138149077-138149099 CAAAAATTACAGAATAGGCCAGG + Intergenic
1033068917 7:138183596-138183618 TAAAAAGAAAATAGTAGGCCGGG - Intergenic
1033175868 7:139123122-139123144 TAAAAAGCATTGAATTGGCCAGG - Intergenic
1033268294 7:139906349-139906371 AAAAGATGCTAGAGTAGGCCAGG - Intronic
1033347377 7:140536055-140536077 AGAAATTCATAGAGAAGGCCGGG + Intronic
1033649919 7:143333001-143333023 TGAAAACCATAGAGTTGGCCAGG + Intronic
1033805413 7:144948829-144948851 TAAATATCCAAGGGTAGGCCAGG + Intergenic
1033831381 7:145257956-145257978 TAAAAGACATAGAGTGGGCCAGG + Intergenic
1034080054 7:148268361-148268383 TAAAAATAATAGACTGGGCGTGG + Intronic
1034327327 7:150248365-150248387 AAAAAAAAAAAGAGTAGGCCGGG + Intronic
1034642033 7:152611793-152611815 TAAAAATTAAAAACTAGGCCGGG - Intergenic
1034765882 7:153721084-153721106 AAAAAAAAAAAGAGTAGGCCGGG - Intergenic
1034784909 7:153916700-153916722 TAAAAATAAAAAAGAAGGCCGGG - Intronic
1035009209 7:155698071-155698093 TAAAAATTATACAGAAGGCCAGG + Intronic
1035028413 7:155842198-155842220 TAAAAAACAAATAGTAGGGCCGG + Intergenic
1035697145 8:1606978-1607000 TAAAACTCATACAGGAGGCCGGG - Intronic
1035738662 8:1908525-1908547 TAAAAATCAAAGTGTGGGCCGGG - Intronic
1036532321 8:9603348-9603370 TAAAAATCATAGTTAAGGTCAGG - Intronic
1036704614 8:11037562-11037584 TAAAAATGATTGAATGGGCCGGG + Intronic
1037091625 8:14926932-14926954 TTAAAATCAAAGTGTCGGCCAGG - Intronic
1037132052 8:15418708-15418730 TAAGAATTAAAGATTAGGCCAGG + Intronic
1037421227 8:18705230-18705252 TAAAAATGAGGGACTAGGCCAGG + Intronic
1037593485 8:20333411-20333433 TAAAAACTATAGTATAGGCCAGG - Intergenic
1037652233 8:20849266-20849288 TTAAAATCTTATAGTTGGCCAGG + Intergenic
1037958005 8:23073685-23073707 ATAAAATAATAAAGTAGGCCGGG - Intergenic
1038020158 8:23545839-23545861 TAAAAATAAAAAAATAGGCCGGG + Intronic
1038124227 8:24653380-24653402 TATAAATGATAGAATAAGCCAGG + Intergenic
1038246757 8:25865094-25865116 TAAGAATAATTGAGAAGGCCGGG - Intronic
1038296748 8:26298977-26298999 TCAAAATAATAGAACAGGCCAGG + Intronic
1038318863 8:26510855-26510877 TAAAAAAGTTAGAGTTGGCCAGG + Intronic
1038533541 8:28337884-28337906 TAAAAATGGAAGTGTAGGCCGGG - Intronic
1038614261 8:29077985-29078007 TCAAAAGCAGAGAGGAGGCCAGG + Intronic
1038749922 8:30285597-30285619 TAAAAATCTTCAGGTAGGCCAGG + Intergenic
1038840484 8:31180407-31180429 TAAAAAATATATAGTGGGCCAGG + Intergenic
1038859391 8:31370143-31370165 AAAAAATAAAAGAATAGGCCAGG - Intergenic
1039160700 8:34615722-34615744 TGAAAATAATAGGCTAGGCCAGG - Intergenic
1039440841 8:37594355-37594377 TAATGATCCCAGAGTAGGCCTGG - Intergenic
1039486893 8:37917092-37917114 TAAAAATTATGGTGAAGGCCAGG + Intergenic
1039653667 8:39374347-39374369 TAAAAATGTTAGAGTAGGCTGGG + Intergenic
1039958491 8:42225573-42225595 TGAAAATAACAAAGTAGGCCGGG - Intergenic
1039975584 8:42361965-42361987 TAGAAAACATAGAGATGGCCGGG + Intronic
1040101337 8:43509423-43509445 TAAAAACTAAAGAGTTGGCCAGG - Intergenic
1040507737 8:48066522-48066544 TTAAAATTATAAAGTGGGCCCGG + Intergenic
1040615736 8:49036519-49036541 TAAAAATCCTGGATGAGGCCGGG + Intergenic
1040912647 8:52536233-52536255 TGAAAATCATAGAGGATGGCTGG - Intronic
1040927410 8:52698984-52699006 AAAAAATCATATTGAAGGCCGGG - Intronic
1040930178 8:52726014-52726036 TAATAATAATAAAATAGGCCAGG + Intronic
1041063358 8:54058245-54058267 AAAAAATCACAGAATTGGCCAGG + Intronic
1041118511 8:54563842-54563864 TCAAAAACAAATAGTAGGCCGGG - Intergenic
1041309471 8:56500778-56500800 TAAAAATCATAGATACAGCCAGG + Intergenic
1041465491 8:58154042-58154064 TAAAAATAACAGAGTTGGCTGGG - Intronic
1041496387 8:58489846-58489868 TAAAACACATAGATTCGGCCAGG + Intergenic
1041912500 8:63103902-63103924 TTAAAATGATAAAGTAGGGCAGG + Intergenic
1041913203 8:63112077-63112099 TAAAAATCATTTAGCTGGCCGGG + Intergenic
1041939944 8:63375822-63375844 TAAAAGTCCTATAATAGGCCAGG + Intergenic
1042133484 8:65612063-65612085 TAAAAATGAAAGTGTAGGCCGGG - Intronic
1042295872 8:67217007-67217029 AAAAAATCATAAAATTGGCCAGG + Intronic
1042569122 8:70143241-70143263 AAAAAAACACAGACTAGGCCAGG - Intronic
1043044233 8:75300940-75300962 TAAAAAGTATAGACTTGGCCGGG + Intergenic
1043420701 8:80095649-80095671 TAAAATACAAAGACTAGGCCGGG + Intronic
1043470045 8:80553289-80553311 TAAAACACATAGATGAGGCCGGG + Intergenic
1043868640 8:85404080-85404102 TTAAAATTGTAGAGTAGGGCCGG - Intronic
1044676497 8:94733835-94733857 TAAAAATTAAAGTATAGGCCGGG - Intronic
1044706977 8:95018330-95018352 TAAAAATTCTAAAGCAGGCCAGG - Intronic
1044735144 8:95271252-95271274 TGGAAATCATAGAATATGCCAGG - Intergenic
1044849140 8:96410773-96410795 TAAAAATCCCAAAGTTGGCCGGG + Intergenic
1045033226 8:98157170-98157192 TAAAAATCAAAGCACAGGCCGGG - Intronic
1045069982 8:98492933-98492955 TAAAAATCATCAAGTATGCCAGG + Intronic
1045124774 8:99077463-99077485 CAAAAATGAAAGAGCAGGCCAGG - Intronic
1045263042 8:100594005-100594027 GAAAAACTATAGAGTGGGCCAGG + Intronic
1045697233 8:104823385-104823407 AAAAAGTCAAAAAGTAGGCCAGG + Intronic
1045869362 8:106907580-106907602 TAATAATAATAGAATAGGCTGGG - Intergenic
1046266975 8:111843366-111843388 AAGAAATGATAGAGAAGGCCTGG + Intergenic
1046392009 8:113586666-113586688 TAAATATCTTAGAGAAGGCCAGG - Intergenic
1046510108 8:115191422-115191444 TAAAAAGGATAAATTAGGCCGGG - Intergenic
1046711859 8:117519886-117519908 AAAATATCAGACAGTAGGCCGGG + Intergenic
1047460533 8:125060189-125060211 TTTAAATAATAGAGTTGGCCGGG + Intronic
1047801706 8:128317012-128317034 TAAAAATCAAAGAGTAACCTTGG - Intergenic
1048367455 8:133750757-133750779 CAAGAATTTTAGAGTAGGCCGGG - Intergenic
1048960957 8:139576655-139576677 TAAAAATCATTTAGTAGGTCAGG - Intergenic
1049270028 8:141690611-141690633 TAAAAATCATGGAGTAATCCAGG - Intergenic
1049561551 8:143314300-143314322 TAAAAATCACAAAGTTGGCCAGG + Intronic
1049779297 8:144421086-144421108 TAAAAAAAATAAAATAGGCCGGG + Intergenic
1049836156 8:144736785-144736807 TAACAATAATAAAGTAGGCCGGG - Intronic
1049910754 9:265225-265247 TAAAAATCAAGGTTTAGGCCGGG - Intronic
1050166627 9:2771053-2771075 TAAAAGTCATTGATGAGGCCAGG - Intronic
1050247891 9:3710427-3710449 TAAAAATCTTATAATAGGCTGGG - Intergenic
1050328262 9:4518525-4518547 TAAAAACCATACTGTAGGCCAGG - Intronic
1050358924 9:4809601-4809623 TAAAAAGCATAGTCTTGGCCGGG - Intronic
1050400719 9:5250745-5250767 AAAAAATAATAGAGTTGGCATGG + Intergenic
1050532947 9:6606775-6606797 TAAAAAATACTGAGTAGGCCGGG + Intronic
1050664544 9:7920794-7920816 AAAAAATTATAGATTGGGCCAGG + Intergenic
1051424355 9:16918662-16918684 AAAAGATGATAAAGTAGGCCGGG + Intergenic
1051476355 9:17513106-17513128 ATAAAATGATAGACTAGGCCGGG - Intergenic
1051609160 9:18944612-18944634 TAAAAGTTATAGAGTAGGGAAGG + Intronic
1052189341 9:25640028-25640050 TAAAAATTAAAACGTAGGCCAGG + Intergenic
1052446929 9:28575106-28575128 TAAAAATCAAACACCAGGCCAGG + Intronic
1052480668 9:29021361-29021383 TGAAAAGCATCGACTAGGCCAGG + Intergenic
1052763486 9:32616964-32616986 TAAAAAGGATAGAAGAGGCCAGG + Intergenic
1052914620 9:33915140-33915162 AAAAAATCAAATAGTTGGCCAGG + Intronic
1052919342 9:33951316-33951338 AAAAAATCATTGGGGAGGCCAGG - Intronic
1053088582 9:35251257-35251279 AAAAAATGGAAGAGTAGGCCGGG - Intronic
1053093182 9:35298613-35298635 TAAAAATCTTCCAGAAGGCCAGG - Intronic
1053194167 9:36102658-36102680 AAAAAATGATAGTCTAGGCCAGG + Intronic
1053247096 9:36543467-36543489 TAATAATAATAAAATAGGCCGGG + Intergenic
1053247245 9:36544636-36544658 TAAAAATAATAAAATAGGCCGGG - Intergenic
1053253000 9:36590782-36590804 TAAAAATCATAATTTTGGCCGGG + Intronic
1053392019 9:37742601-37742623 TAAAAACTATAGATTTGGCCGGG + Intronic
1053460234 9:38263089-38263111 TAACAATAAGAGAGTAGGCTGGG + Intergenic
1054762399 9:69014578-69014600 TAAAACTCATAGAACTGGCCGGG + Intergenic
1054774509 9:69113790-69113812 TAAAAAAGATAGAGGAGGCTGGG - Intergenic
1055444696 9:76371019-76371041 AAAAAATCAAAGAAAAGGCCAGG + Intergenic
1055894406 9:81158807-81158829 TAAAATACATAAAATAGGCCGGG + Intergenic
1056204749 9:84309225-84309247 TAAAAATCAAATGGGAGGCCTGG + Intronic
1056282848 9:85058829-85058851 TAATAATAATAGAGAAGGACAGG - Intergenic
1056306422 9:85295124-85295146 TAAATATTATACAATAGGCCAGG + Intergenic
1056334657 9:85555302-85555324 AAAAAATAAGACAGTAGGCCGGG + Intronic
1056360968 9:85857126-85857148 TAAAAATCCCAGATGAGGCCAGG + Intergenic
1056629027 9:88277465-88277487 TAAAGTCCATAGTGTAGGCCAGG - Intergenic
1056980117 9:91302168-91302190 TAATAATCAAAGAGGGGGCCGGG + Intronic
1057281854 9:93718965-93718987 TAAAAATCTAAGCCTAGGCCAGG + Intergenic
1057408695 9:94797136-94797158 TAAAAAGCACAGAATTGGCCAGG + Intronic
1057564179 9:96153649-96153671 TAAAAATAATTAATTAGGCCGGG - Intergenic
1057782046 9:98057718-98057740 AAAGAATCATAGTGCAGGCCAGG - Intronic
1058004767 9:99903247-99903269 TAGAAATCATAAAGGGGGCCTGG + Intergenic
1058050772 9:100404076-100404098 TAAAAGTCATAAAGTAGGCCAGG - Intergenic
1058157248 9:101529448-101529470 TAAAAAGCTGAGAGAAGGCCGGG - Intronic
1058237259 9:102505036-102505058 TAAAAATTAAAAAATAGGCCTGG - Intergenic
1058468237 9:105250169-105250191 TAAAGATAAAAAAGTAGGCCGGG - Intronic
1058558097 9:106191892-106191914 TAGAACTGATAAAGTAGGCCGGG - Intergenic
1058701543 9:107604793-107604815 TAAAAATCTTGAAGTGGGCCGGG - Intergenic
1059116660 9:111605977-111605999 TAAAAATATTATAGTAGGCTAGG + Intergenic
1059204386 9:112450332-112450354 AAAAAAGCATAGAACAGGCCAGG + Intronic
1059477085 9:114555993-114556015 TAAAAATCACAGGGTAGGCCAGG + Intergenic
1059562932 9:115352707-115352729 TAAAAGTCATCAGGTAGGCCTGG - Intronic
1059633187 9:116147011-116147033 TAAAACACAGAGGGTAGGCCGGG + Intergenic
1059744480 9:117186833-117186855 CAAAAATTATAAAGAAGGCCGGG + Intronic
1060024896 9:120162562-120162584 TAAATATCACAGAGCAGGCACGG - Intergenic
1060085593 9:120697376-120697398 TAAAAGTCATAGAATAGACTGGG - Intronic
1060124745 9:121032702-121032724 TCAAAAACATATACTAGGCCAGG + Intronic
1060638988 9:125222966-125222988 TAAAAATGATGGTGAAGGCCGGG - Intronic
1060667609 9:125441830-125441852 TAAAAATCAGAGATGGGGCCGGG + Intronic
1061340846 9:129980063-129980085 TAAAAATCAGAGTGCCGGCCGGG + Intronic
1061566346 9:131443429-131443451 TAAAAATAAAAAAATAGGCCAGG - Intronic
1061970603 9:134043132-134043154 TACAAAAAATAAAGTAGGCCGGG - Intronic
1062215637 9:135388181-135388203 TAAAAAGCATTTAGGAGGCCGGG + Intergenic
1062258216 9:135641342-135641364 GAAAAATTAAAGGGTAGGCCGGG + Intergenic
1062604444 9:137339366-137339388 CAAAAATCACAGACCAGGCCGGG + Intronic
1185602456 X:1349605-1349627 TAAAAAACAAAGAAGAGGCCAGG - Intronic
1185726020 X:2422600-2422622 TAAACATCATACTGTAGGTCTGG - Intronic
1185748012 X:2587016-2587038 TAAAAATCACATTATAGGCCGGG - Intergenic
1185776095 X:2804137-2804159 TAAAAATTATAGTTTAGGGCTGG - Intronic
1186222337 X:7363367-7363389 TAAAAAAGATACAGTAGGCTGGG + Intergenic
1186407262 X:9315023-9315045 TAAAAATCGCAGTGTTGGCCGGG - Intergenic
1186513244 X:10146950-10146972 TAAAAATAATTGAACAGGCCGGG + Intergenic
1186662662 X:11684855-11684877 TAAAAATACTGGAGCAGGCCTGG - Intergenic
1187150947 X:16680888-16680910 TAAAAATTAAAAAATAGGCCAGG + Intronic
1187155404 X:16716528-16716550 TAAAAATAAGAGATTAGGCTGGG - Intergenic
1187346391 X:18469040-18469062 AAAAAATCATTGAATAGGGCTGG + Intronic
1187488923 X:19731232-19731254 TATAAATGAAAGTGTAGGCCGGG - Intronic
1187517201 X:19983278-19983300 TAAAAATAAAAGGTTAGGCCGGG + Intergenic
1187530810 X:20094957-20094979 TAAAAATCAGTGACTAGGCCGGG + Intronic
1187859721 X:23669217-23669239 TAAAAATCTCAAAGTAGGCTGGG - Intronic
1187899250 X:24011852-24011874 TAAAAACGGTAGAGTAGGCCAGG + Intronic
1188005672 X:25014266-25014288 TAAAAATGAGAGAGTAGGAAAGG - Intronic
1188014250 X:25090461-25090483 TAAAAATAATAAAATAGGCTGGG - Intergenic
1188132763 X:26458007-26458029 TAAAAATCATTCTGAAGGCCGGG + Intergenic
1188204693 X:27340532-27340554 TTAAAAACATGAAGTAGGCCAGG - Intergenic
1188258629 X:27994947-27994969 TAAAAATAAAAGACAAGGCCGGG - Intergenic
1188401115 X:29745741-29745763 TAAAAATTAAAGAATAGGGCTGG - Intronic
1188469793 X:30525486-30525508 TAAAGATCATAGAGTTGGCTGGG + Intergenic
1188617040 X:32170173-32170195 TAAAAAAGAAAGAGTGGGCCAGG + Intronic
1188795819 X:34463083-34463105 TAAAAATCATTCAATTGGCCGGG + Intergenic
1188861937 X:35268808-35268830 TAAGAATGATACAGTGGGCCGGG + Intergenic
1189102735 X:38208024-38208046 TCATAATGATAGAGAAGGCCAGG - Intronic
1189425370 X:40895746-40895768 TAAAAATTTTAAAGTAGGCCGGG + Intergenic
1189681881 X:43525639-43525661 TAAAAATCACAAAGACGGCCAGG + Intergenic
1190095294 X:47474883-47474905 AAAAAAAAAAAGAGTAGGCCGGG + Intronic
1190251880 X:48733103-48733125 AAAAAATAATAAAATAGGCCGGG - Intergenic
1190286560 X:48965344-48965366 TAGAAAGCATAGAGCAGGCCGGG - Intronic
1190492141 X:50992843-50992865 TAAAAATTCCAGATTAGGCCAGG - Intergenic
1190794821 X:53731162-53731184 AGAAAATCATTGAGGAGGCCAGG + Intergenic
1191234901 X:58126499-58126521 TTAGAATAATAGGGTAGGCCAGG - Intergenic
1191241526 X:58193812-58193834 TAGAAAGCCTAGAGTTGGCCAGG - Intergenic
1191247905 X:58242537-58242559 TAAAATTAATGGAGTAGGCCAGG - Intergenic
1192461589 X:71321660-71321682 TAAAAATTAAAAATTAGGCCGGG - Intergenic
1193207963 X:78771384-78771406 TATAAATCACAGAGAAGTCCTGG - Intergenic
1193268265 X:79498975-79498997 TAAAGATCAGATAGTTGGCCAGG - Intergenic
1193326661 X:80185887-80185909 TAAAAATAAAGAAGTAGGCCTGG - Intergenic
1194160421 X:90442717-90442739 AAAAAATGCTAGAGTAGGTCAGG + Intergenic
1194720852 X:97338165-97338187 TAAAAATCAGATTATAGGCCAGG - Intronic
1195295302 X:103470574-103470596 TAAAAATCCCATAGAAGGCCAGG - Intergenic
1195546041 X:106113713-106113735 TTAAAAACATAAAGTTGGCCAGG - Intergenic
1195892903 X:109715341-109715363 TTAAAATCATAAAACAGGCCAGG + Intronic
1196097733 X:111817617-111817639 TAAAAATCAGAAAAGAGGCCGGG - Intronic
1196098590 X:111825551-111825573 TGAAAGTCCTAGAGTGGGCCGGG - Intronic
1196729769 X:118929107-118929129 TAAAAAACACAAACTAGGCCAGG - Intergenic
1197228212 X:123974870-123974892 TGAAAATCAAATACTAGGCCGGG - Intronic
1197334807 X:125200181-125200203 TAAAAATAATATATTAAGCCAGG + Intergenic
1197767776 X:130070138-130070160 TAAAAAGCAAAAAGGAGGCCAGG + Intronic
1197998021 X:132401320-132401342 CAAAAATTAAAAAGTAGGCCAGG + Intronic
1198343366 X:135736120-135736142 TTAAAATCATAGAATGGGCCGGG - Intergenic
1198620026 X:138497138-138497160 TAAAAATATCAGAGAAGGCCAGG - Intergenic
1199213754 X:145244142-145244164 TAAAAAGAGTAGAGTCGGCCGGG - Intergenic
1199227654 X:145395977-145395999 TAAAAACCATACAATTGGCCAGG - Intergenic
1199228406 X:145407053-145407075 TAAAAAAAAAAGAGGAGGCCGGG + Intergenic
1199394427 X:147318083-147318105 GAAAAATAATAAAGTTGGCCTGG + Intergenic
1199781751 X:151067774-151067796 AAAAAATCAAAAAGTTGGCCAGG - Intergenic
1199804680 X:151286514-151286536 TAAGAATCCTAGAAGAGGCCAGG - Intergenic
1200156211 X:153977317-153977339 TAAAAATAATAAAATAGGCTGGG + Intronic
1200429843 Y:3066346-3066368 TAAAAATGATTGTTTAGGCCGGG - Intergenic
1201275462 Y:12293386-12293408 TAAAAATGATACATTCGGCCTGG - Intergenic
1201664870 Y:16439554-16439576 TAAAAATAAAAGACTGGGCCAGG - Intergenic
1201794813 Y:17883501-17883523 TAAAAATCATAAAGTTAGCCAGG - Intergenic
1201806742 Y:18022484-18022506 TAAAAATCATAAAGTTAGCCAGG + Intergenic
1201983755 Y:19938798-19938820 AAAAATACATAGAATAGGCCGGG + Intergenic
1202356188 Y:24051280-24051302 TAAAAATCATAAAGTTAGCCAGG - Intergenic
1202514590 Y:25618829-25618851 TAAAAATCATAAAGTTAGCCAGG + Intergenic
1202590158 Y:26474120-26474142 TAAAAATCAAATAGAATGCCTGG + Intergenic