ID: 990963406

View in Genome Browser
Species Human (GRCh38)
Location 5:61418553-61418575
Sequence ATAAAAATCATAGAGTAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 827
Summary {0: 1, 1: 0, 2: 8, 3: 93, 4: 725}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990963406_990963409 16 Left 990963406 5:61418553-61418575 CCGGCCTACTCTATGATTTTTAT 0: 1
1: 0
2: 8
3: 93
4: 725
Right 990963409 5:61418592-61418614 AGTGACTATCTAGATGAGTGAGG No data
990963406_990963411 18 Left 990963406 5:61418553-61418575 CCGGCCTACTCTATGATTTTTAT 0: 1
1: 0
2: 8
3: 93
4: 725
Right 990963411 5:61418594-61418616 TGACTATCTAGATGAGTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 130
990963406_990963410 17 Left 990963406 5:61418553-61418575 CCGGCCTACTCTATGATTTTTAT 0: 1
1: 0
2: 8
3: 93
4: 725
Right 990963410 5:61418593-61418615 GTGACTATCTAGATGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990963406 Original CRISPR ATAAAAATCATAGAGTAGGC CGG (reversed) Intronic
900233169 1:1572751-1572773 ATAACAAAGATGGAGTAGGCCGG - Intronic
900892713 1:5461081-5461103 GCTAGAATCATAGAGTAGGCAGG - Intergenic
901256513 1:7832667-7832689 ATAAAAATTAGAGCATAGGCTGG - Intronic
901907341 1:12425259-12425281 TTAAAAATCAGAAAGCAGGCCGG + Intronic
902354255 1:15885263-15885285 ATTAAAATCAAAGAATGGGCTGG - Intronic
902589624 1:17464454-17464476 ATAAAAATCAGAGTTTAGGCCGG + Intergenic
902972880 1:20067820-20067842 ATTAAAATCAGAGGGGAGGCCGG + Intronic
904069027 1:27778527-27778549 CTAAAAATCAAAAAGTAAGCCGG + Intronic
904622664 1:31784651-31784673 ATAAAAGTCAGACAGAAGGCTGG + Intergenic
904648186 1:31984240-31984262 TAAAAAATCAGACAGTAGGCCGG + Intergenic
904774678 1:32899544-32899566 ATAAAAATAAAAAATTAGGCAGG + Intronic
905635257 1:39546764-39546786 AAAAAAACAATAGAGTTGGCCGG - Intergenic
906022534 1:42642785-42642807 AAAAATATCATGGAGGAGGCTGG + Intronic
906218677 1:44060171-44060193 ATAAAAAACTTGGAATAGGCTGG + Intergenic
906756670 1:48324108-48324130 ATAATAATAATAGAGTAGATAGG - Intronic
906918196 1:50034408-50034430 TTAAAACTAATAGAGGAGGCTGG - Intergenic
906982904 1:50650309-50650331 ATAAAACTGAAAGAGTTGGCCGG + Intronic
907111414 1:51929610-51929632 ATAAAAAAAATAGAATTGGCTGG - Intronic
907431251 1:54413244-54413266 ATAAAATTTTTAGAGGAGGCTGG - Intronic
907510156 1:54951965-54951987 AAAAAAATCATAGAGTTCGTGGG + Intergenic
908224650 1:62043886-62043908 AAAAAAATCTTATAGTAGCCAGG - Intronic
908268396 1:62400110-62400132 AAAAAAATAATAAAATAGGCCGG + Intergenic
908278990 1:62509543-62509565 TTAGAAATCACAGAGTAGCCAGG - Intronic
908478932 1:64517867-64517889 ATCAATGACATAGAGTAGGCAGG - Intronic
908740176 1:67319246-67319268 CAAAAATTCATAAAGTAGGCTGG - Intronic
909543295 1:76815140-76815162 AGAAAATTCATAGATTAGGAAGG + Intergenic
910406511 1:86897007-86897029 AAAAAAATCAAAGAGCAGGCCGG + Intronic
910455782 1:87395860-87395882 TTAAAAATAATAGAGTTGGCCGG - Intergenic
910490075 1:87758930-87758952 ATAAAAATCTTAGTGTCGGTTGG + Intergenic
910608753 1:89116308-89116330 TTAAAAATGATTGAGTTGGCTGG - Intronic
910788475 1:91025864-91025886 ATAAAAAACATAAAGTGGCCAGG + Intergenic
910908791 1:92211886-92211908 ATAATAATAATAAAATAGGCTGG - Intergenic
911009577 1:93265204-93265226 TTTAAAATCATAAAGTAGGCCGG + Intronic
911011191 1:93282581-93282603 ATAAAATACATATTGTAGGCCGG + Intergenic
911544136 1:99196283-99196305 ATAAAAGTCAAAAAGTTGGCTGG + Intergenic
912016416 1:105042502-105042524 TTAAAAGACATAGAGTGGGCAGG + Intergenic
913407241 1:118508688-118508710 ATAAAAATCATTCAGCAAGCAGG - Intergenic
913570703 1:120117164-120117186 ATAAAAAACATAGAATTGGCCGG - Intergenic
913602727 1:120437565-120437587 ATAAAAAGCAGAGAGTAGCTTGG + Intergenic
913603475 1:120443918-120443940 ATAAAAAGCAGAGAGTAGCTTGG + Intergenic
913604232 1:120450261-120450283 ATAAAAAGCAGAGAGTAGCTTGG + Intergenic
913641106 1:120812972-120812994 ATAAAAAGCAGAGAGTAGCTTGG + Intronic
914084306 1:144438944-144438966 ATAAAAAGCAGAGAGTAGCTTGG - Intronic
914190327 1:145404215-145404237 ATAAAAAGCAGAGAGTAGCTTGG - Intronic
914277377 1:146137352-146137374 ATAAAAAGCAGAGAGTAGCTTGG - Intronic
914291510 1:146278140-146278162 ATAAAAAACATAGAATTGGCCGG - Intergenic
914364661 1:146967530-146967552 ATAAAAAGCAGAGAGTAGCTTGG + Intronic
914365428 1:146973817-146973839 ATAAAAAGCAGAGAGTAGCTTGG + Intronic
914487018 1:148119622-148119644 ATAAAAAGCAGAGAGTAGCTTGG - Intronic
914538425 1:148588300-148588322 ATAAAAAGCAGAGAGTAGCTTGG - Intronic
914552554 1:148728923-148728945 ATAAAAAACATAGAATTGGCCGG - Intergenic
914587351 1:149074767-149074789 ATAAAAAGCAGAGAGTAGCTTGG - Intronic
914891309 1:151625965-151625987 ATAAAAATAAAAGATTGGGCCGG + Intronic
915365438 1:155312682-155312704 ATAAAAGTGACAGAGGAGGCCGG + Intronic
915509005 1:156376039-156376061 ATAAAAATAATATATAAGGCTGG - Intronic
915830611 1:159126349-159126371 CTAAAATTGATAGAATAGGCCGG + Intronic
915940050 1:160113405-160113427 AGAGAAATCAAAGAGTGGGCAGG - Intergenic
916232037 1:162550072-162550094 CCAAAAATCTTAGAGTCGGCCGG - Intergenic
917384486 1:174454845-174454867 TTAAAAATCCTACAGTGGGCCGG - Intronic
917592843 1:176494970-176494992 GTAAAAATCAAAGAGTAAGATGG - Intronic
917627972 1:176864805-176864827 TTAAAAATCATAGAGTTGGCAGG + Intronic
917641928 1:176991109-176991131 ATAAAAATTATAGAGCCGGCCGG + Intronic
917951713 1:180045043-180045065 ATAAAAAATATTGAATAGGCCGG + Intronic
917986381 1:180324173-180324195 TCAAAAGACATAGAGTAGGCCGG - Intronic
918337405 1:183532148-183532170 ACAAAAATCTCAGAGTAGTCTGG + Intronic
919583753 1:199409834-199409856 ATAATAATAATAATGTAGGCTGG - Intergenic
919596177 1:199565259-199565281 GTAAAAACCTTAGAGTAGTCGGG - Intergenic
922747722 1:228054857-228054879 ATAAAAATTATATAATAGGCTGG + Intronic
922771525 1:228186539-228186561 AGAAAAAACATAGAAGAGGCTGG - Intergenic
923288597 1:232521804-232521826 ATAAAATTAAAAGAGAAGGCAGG - Intronic
923437065 1:233977359-233977381 AGAAAATTCACAGAGAAGGCAGG + Intronic
923670908 1:236040497-236040519 ATAAAACTCTTAGAGAAGTCTGG - Intronic
924120089 1:240788839-240788861 AGAAAAATAATGAAGTAGGCAGG + Intronic
1062866364 10:858853-858875 AAAAAAATCAGAAAATAGGCTGG + Intronic
1063060974 10:2552298-2552320 AAAAAAATCAAAGATGAGGCTGG - Intergenic
1063061630 10:2561393-2561415 ATAAAAATCCTGTAGTTGGCTGG + Intergenic
1063277939 10:4591776-4591798 ATAAAAATCATAAAGTATTTGGG - Intergenic
1063633937 10:7762957-7762979 TTTAAAATCTCAGAGTAGGCCGG + Intronic
1063853462 10:10220238-10220260 ATATAATTAATAGTGTAGGCTGG - Intergenic
1064044266 10:11997819-11997841 ATAAAAATATCATAGTAGGCAGG - Intronic
1064428097 10:15247767-15247789 ATAAAAATGATATAGTAGGCTGG - Intronic
1064453275 10:15463256-15463278 AAAAAAGTCAGAGAGGAGGCTGG - Intergenic
1064590411 10:16884276-16884298 ATTAAAATTAGATAGTAGGCCGG - Intronic
1065034759 10:21626372-21626394 ATAAGAATCATAGACTTGGGGGG - Intronic
1065577982 10:27143011-27143033 ATAAAAAAGATAATGTAGGCTGG - Intronic
1065919830 10:30383194-30383216 ATAAAAACCATAGAGAACTCAGG - Intergenic
1067416812 10:46108969-46108991 ATAGAACTCATAGAGGAAGCTGG + Intergenic
1067502211 10:46815852-46815874 ATAGAACTCATAGAGGAAGCTGG + Intergenic
1068507617 10:57922456-57922478 AAAAAAAAAATACAGTAGGCTGG + Intergenic
1068879353 10:62032156-62032178 ATAAAAATAAAAAAGTAGTCAGG + Intronic
1069308728 10:67005980-67006002 AAAAAAATCATGGAGTAGGTTGG - Intronic
1069527497 10:69185794-69185816 AGAAAAATGATCGAGTTGGCCGG - Intronic
1070295251 10:75155187-75155209 TTAAAAATCTTGGAATAGGCTGG - Intronic
1070396804 10:76018255-76018277 ATAAACATCATACAATATGCAGG - Intronic
1071530751 10:86389052-86389074 TTAAAAAGCATAGACTGGGCCGG - Intergenic
1071704606 10:87983408-87983430 ATAAAAATAAGTGAGTGGGCCGG - Intergenic
1071866766 10:89742995-89743017 ATAAAAAGCATAGAGAAGGCCGG - Intronic
1072446189 10:95500795-95500817 TTTAACATCATAGAGTTGGCAGG - Intronic
1072653683 10:97315631-97315653 TTAAAACTCATTGAGTGGGCTGG - Intergenic
1072686713 10:97542030-97542052 TTAAGAATCAGAGAGGAGGCCGG - Intronic
1072852092 10:98906607-98906629 TTAAAAATGCTAGAATAGGCTGG + Intronic
1072865414 10:99055006-99055028 AAAAATATTGTAGAGTAGGCCGG - Intronic
1073236278 10:102019343-102019365 ATAAAAAGTATAGTATAGGCTGG - Intronic
1073777820 10:106806071-106806093 AAAGAAATCATGGAGTAGGCCGG + Intronic
1074584980 10:114759240-114759262 ATTAAAATCATACAATATGCTGG + Intergenic
1077644985 11:3915691-3915713 ATAAAAATTAAAAACTAGGCCGG - Intronic
1077815836 11:5684649-5684671 TTAAAAAGTATAGAGTAGGGAGG + Intronic
1078517563 11:12036649-12036671 CTAAAAAACATAGAGGAGGAGGG + Intergenic
1078774274 11:14380210-14380232 TAAAAAATCATATTGTAGGCTGG + Intergenic
1078818604 11:14852349-14852371 AATAAAAACATAGAGTAGGCCGG - Intronic
1079504790 11:21141720-21141742 ATAAAAAGGATAGAGGAGGAGGG - Intronic
1079626909 11:22627086-22627108 ATAAAAATCAAATAATAGCCGGG - Intronic
1079677644 11:23250669-23250691 ATAAAAATCACAGCAAAGGCCGG - Intergenic
1080228449 11:29987614-29987636 ATAGAAACCATGGAGTAGGAAGG + Intergenic
1081248830 11:40803767-40803789 ATAAAAATTAAAAATTAGGCCGG - Intronic
1081518874 11:43862055-43862077 CTAAAAATCAGAGGTTAGGCTGG - Intergenic
1081597986 11:44472446-44472468 AAAAAAATCTTATAGTAGACTGG + Intergenic
1081835902 11:46154132-46154154 TTAAAAATGATAAAATAGGCTGG + Intergenic
1082014459 11:47474191-47474213 TAGAAAATCATTGAGTAGGCTGG - Intronic
1082053262 11:47790591-47790613 AAGAAAATCATAGGGAAGGCAGG + Intronic
1082218341 11:49601776-49601798 TTAAAAATAAAAGAATAGGCTGG - Intergenic
1082747681 11:56984071-56984093 ATTGAATTCATAGAGTAAGCTGG + Intergenic
1083158059 11:60837615-60837637 ATACAGATCATGGAGTAGGGAGG + Intergenic
1084291585 11:68173335-68173357 ATAAAAATAGTAGAGTTGGTGGG - Intronic
1084299861 11:68241280-68241302 ATAAAAAACTTACAATAGGCTGG - Intergenic
1084311606 11:68319509-68319531 ATAATAATAATAAAATAGGCTGG - Intronic
1084613981 11:70222750-70222772 TTAAAAGGCATAGAGTGGGCCGG + Intergenic
1085087381 11:73679020-73679042 ATAAAAAACATAAAACAGGCCGG - Intronic
1085425529 11:76401437-76401459 TTAAAATTCATAGGTTAGGCTGG - Intronic
1085669355 11:78448059-78448081 ATAAAAATGATAGATAAGTCAGG + Intronic
1085730029 11:78989755-78989777 ATAAAAATGATGGTTTAGGCTGG + Intronic
1086034226 11:82397079-82397101 ATAAAAATGATTGAGTGGCCAGG - Intergenic
1086040820 11:82476060-82476082 ATAAGAATAAAAGAGCAGGCTGG - Intergenic
1086507471 11:87520877-87520899 TTAAAAACCATAGGCTAGGCCGG - Intergenic
1086631233 11:89022344-89022366 TTAAAAATAAAAGAATAGGCTGG + Intronic
1086657347 11:89375602-89375624 TTAAAAATCACAGTGTGGGCTGG - Intronic
1086801060 11:91175817-91175839 ATAATAATCATAAATTAGGCCGG - Intergenic
1086959945 11:92971255-92971277 CTAAAAATCCTAGAGTTGGCCGG - Intronic
1087647435 11:100824737-100824759 ACACAAATCATGGAGTAGGGAGG - Intronic
1088281085 11:108135411-108135433 GTCAAAATGATAGCGTAGGCTGG + Intronic
1088861831 11:113807368-113807390 AAAAAAATCATTGACAAGGCTGG - Intronic
1088965297 11:114714725-114714747 ATAAAAATAATAGGGAAGGCTGG + Intergenic
1089736245 11:120552074-120552096 ATCAAACTCAAAGAGTAGGTGGG + Intronic
1089940299 11:122409575-122409597 AGAAAAATGAAAAAGTAGGCTGG + Intergenic
1090499835 11:127250687-127250709 TTAAAAATCATAGCGAAGGCCGG + Intergenic
1090768640 11:129898638-129898660 ATAAAAAATGAAGAGTAGGCTGG - Intergenic
1091233814 11:134005960-134005982 ATAAGAAACAGGGAGTAGGCCGG - Intergenic
1091933007 12:4412303-4412325 ATAAAAATCATATAGGAATCTGG + Intergenic
1092190225 12:6514009-6514031 AAAAATATGATAGAGTTGGCCGG - Intronic
1092215013 12:6675412-6675434 TTAAGAATCTTAAAGTAGGCTGG - Intronic
1092248528 12:6877804-6877826 ATAATAATAATAAAATAGGCCGG + Intronic
1092285255 12:7124894-7124916 ACAAAAAACAAAGAGTAGGGTGG - Intronic
1092871850 12:12812586-12812608 ATAAAAATTACAGAGTAACCTGG - Intronic
1093357446 12:18184748-18184770 ATAAAAAGCATAGAATACGATGG - Intronic
1093464266 12:19434139-19434161 ATAAAAAAACTAGAGTTGGCTGG - Intronic
1094164041 12:27423623-27423645 AAAAAAAGTGTAGAGTAGGCCGG - Intronic
1094279317 12:28717999-28718021 AAGAAAATCATACAGAAGGCCGG + Intergenic
1094583719 12:31757948-31757970 ATAAAAGTCATATTGTTGGCTGG + Intergenic
1095521540 12:43072695-43072717 ATAAGAATCAGAGAGCAGGGAGG + Intergenic
1096061874 12:48708248-48708270 TTAAAAAGTTTAGAGTAGGCCGG + Intronic
1096338963 12:50780797-50780819 ATAAAAATCAAAAATTAGCCAGG + Intronic
1096631570 12:52930202-52930224 AAAAAAATGATAGAATTGGCAGG - Intronic
1096632295 12:52935955-52935977 ATAAAAATTCTAGATAAGGCTGG + Intronic
1096705559 12:53419572-53419594 ATGAAAATAAAAGAGGAGGCCGG - Intergenic
1097216080 12:57414143-57414165 AAAAAAAAGATAGAGTGGGCTGG - Intronic
1097586591 12:61522913-61522935 ATAAAAATTAAAAATTAGGCTGG - Intergenic
1098095697 12:66953580-66953602 AGCAAAATAATAGAGAAGGCAGG + Intergenic
1099032649 12:77546945-77546967 ATAAAAATCCTTGAGTACGGGGG - Intergenic
1099362536 12:81722856-81722878 ATAAAAATCATATTGTATGAAGG - Intronic
1099431956 12:82597527-82597549 AAAAAAATCTTAGTGTAGGTTGG - Intergenic
1099441578 12:82706010-82706032 ATAAAGATGAGAGAGAAGGCTGG + Intronic
1100268071 12:92997534-92997556 TTAAAAATCATAGACTAGTTTGG - Intergenic
1100440597 12:94613796-94613818 ATAAAAACTATGGAGTAGGCCGG + Intronic
1100628540 12:96362513-96362535 ATAAAAATCAAAGTGGAGGCTGG - Intronic
1100894163 12:99160642-99160664 ATAAGAATCCTAGAAGAGGCTGG - Intronic
1101017023 12:100512343-100512365 ATAAAAATGACAATGTAGGCCGG + Intronic
1101596839 12:106174558-106174580 ATAAAAACCAAGGAGTAGGCCGG - Intergenic
1102278964 12:111603477-111603499 ATGAAAATATCAGAGTAGGCTGG + Intergenic
1102325833 12:111982987-111983009 TTAAAAATAATAGTTTAGGCTGG + Intronic
1102747892 12:115266059-115266081 ATTAAAATATTAGAATAGGCTGG + Intergenic
1103070399 12:117936485-117936507 ATAATAATGATAAAGTAGCCAGG - Intronic
1103320327 12:120088958-120088980 GTAAAAACCATAAAGTAGGCCGG - Intronic
1103345412 12:120246228-120246250 ATAAAAATAAAAAATTAGGCTGG + Intronic
1103669163 12:122597541-122597563 TTAAAAATCAGATATTAGGCCGG - Intronic
1103722825 12:122983729-122983751 TTAGAAATCAAAGAGAAGGCAGG + Exonic
1104879265 12:132058644-132058666 ATAAAATCCATAGTCTAGGCTGG - Intronic
1105212135 13:18263212-18263234 ATAAAAATAAAAAATTAGGCTGG - Intergenic
1105832932 13:24181816-24181838 ATAAAAAGTATAGTATAGGCCGG + Intronic
1105878231 13:24579159-24579181 TTAAAAGTCACAGAGTGGGCTGG - Intergenic
1105921971 13:24971489-24971511 TTAAAAGTCACAGAGTGGGCTGG + Intergenic
1105980855 13:25514881-25514903 ATCACAATCATATATTAGGCAGG - Intronic
1106166114 13:27248077-27248099 ATAAAAATGATGGAGTTGGCTGG + Intergenic
1106403899 13:29456839-29456861 ATAAATATAAAAGACTAGGCCGG + Intronic
1106596224 13:31141366-31141388 CTAAAAATCATAAAGTTGGAAGG + Intronic
1107008957 13:35648690-35648712 ATTAAAAACATAAAGTAGGGAGG - Intronic
1107701434 13:43052257-43052279 TTAAAAATCAAAAAATAGGCTGG - Intronic
1108341704 13:49504018-49504040 AAAAAAATCAAAAAGGAGGCTGG - Intronic
1108466890 13:50725631-50725653 TTAAAAATCAAAGAGAAGGCAGG + Intronic
1109254831 13:60067122-60067144 ATAAAAATGAAACATTAGGCAGG + Intronic
1109663452 13:65496889-65496911 ATAAAAAGCATAGTATAGGCCGG + Intergenic
1110208168 13:72942702-72942724 TTAAAAATCCTTTAGTAGGCTGG + Intronic
1110646072 13:77886008-77886030 ATAAAAATCTTTCAGTAGGAGGG + Intergenic
1111149575 13:84232483-84232505 ATAAAAGACATACAGTGGGCTGG - Intergenic
1111227993 13:85301192-85301214 ATAAAAAGCACATAGAAGGCTGG + Intergenic
1111664433 13:91249254-91249276 TTTAAAAACATAGTGTAGGCTGG - Intergenic
1112500206 13:99937195-99937217 ATAAAAATAATAAAGAAAGCTGG - Intergenic
1112592008 13:100772203-100772225 ATCAGAAACAAAGAGTAGGCCGG - Intergenic
1113327007 13:109292204-109292226 ATAAAAATCTTACTGTCGGCCGG + Intergenic
1114179256 14:20351472-20351494 ATAAAATTCTTAGAGAAGGCAGG - Intronic
1114315717 14:21508098-21508120 ATAAAAATTAAAAAGTAGGCAGG + Intronic
1114988430 14:28259844-28259866 ATAAAAATCACAGAGAAGTATGG - Intergenic
1115072175 14:29337170-29337192 ATAAAAATCACAGAACCGGCTGG - Intergenic
1115356335 14:32452328-32452350 TTAAAAATTATAGCATAGGCTGG - Intronic
1115591350 14:34868505-34868527 ATAAAAATCAGAAACTAGGCCGG + Intronic
1115632663 14:35260978-35261000 ATAAAACAAATAGAGTTGGCTGG - Intronic
1115830034 14:37327446-37327468 AAAAAAATCAAAAAGTAGCCGGG - Intronic
1116285236 14:42962599-42962621 AAAAAAATGATAAAGAAGGCTGG + Intergenic
1116299122 14:43154448-43154470 AAAAAAATTAGAGTGTAGGCCGG - Intergenic
1116299454 14:43159096-43159118 ATAAAACACATAGATTAGTCAGG + Intergenic
1117055479 14:51907933-51907955 CTAAAAATTATAGAGTTGACTGG + Intronic
1117206817 14:53451829-53451851 ATAAAAACCATTCAGTGGGCTGG - Intergenic
1117607589 14:57446041-57446063 ATAAAAATAAAAAATTAGGCAGG - Intergenic
1118161702 14:63297337-63297359 AAAAAATGCATAGAATAGGCTGG - Intergenic
1118605992 14:67503996-67504018 ATAAAAATTAAAAAATAGGCTGG - Intronic
1118695522 14:68381377-68381399 AAAAAAGCCATAGAGTTGGCCGG + Intronic
1119054745 14:71407665-71407687 ACAAAAAACATAAATTAGGCAGG - Intronic
1119270977 14:73304471-73304493 ATAAAAATAAAAAAGTAGCCAGG - Intronic
1119362022 14:74058786-74058808 ACAAAAAGCATAGAGGCGGCTGG + Exonic
1119455150 14:74748855-74748877 ATAAAACTCCTAGATTAAGCTGG + Intergenic
1119729257 14:76940534-76940556 AAATAAATGATAGAGAAGGCAGG - Intergenic
1121344391 14:93124625-93124647 ATAAAAATAAAAATGTAGGCTGG - Intergenic
1121957564 14:98228000-98228022 ATAAAAATCACAGAGCAGATTGG - Intergenic
1124431004 15:29608513-29608535 ATAATAATAATAAAGAAGGCAGG - Intergenic
1124899067 15:33805771-33805793 ATAAAAACAAAAGAGAAGGCCGG - Intronic
1125165278 15:36696813-36696835 ATAAAAATTATAGAAAATGCTGG + Intronic
1125787203 15:42330478-42330500 ACAAAAAGCAAACAGTAGGCAGG - Intronic
1126916147 15:53468280-53468302 ATAAAAGGCATCAAGTAGGCTGG - Intergenic
1127078671 15:55353299-55353321 ATAGAAAGACTAGAGTAGGCCGG + Intronic
1127078732 15:55353899-55353921 ATAGAAAGACTAGAGTAGGCCGG - Intronic
1127510268 15:59634065-59634087 AAAAAAATCTTAGAATTGGCCGG + Intronic
1127870041 15:63064667-63064689 TTAAGAATTCTAGAGTAGGCCGG + Intronic
1128644484 15:69365402-69365424 ATAAAATTCATAAAGGAGGCTGG - Intronic
1128831432 15:70772790-70772812 TTAGAAATCAAAGAGAAGGCTGG + Intergenic
1128990473 15:72255552-72255574 TGAAAAATCAGAGAGTGGGCTGG - Intronic
1129196461 15:73970220-73970242 TTAAAAATCAGAAAGGAGGCCGG - Intergenic
1130319074 15:82824760-82824782 ATAAGAAAAATATAGTAGGCTGG - Intronic
1130509552 15:84577690-84577712 ATAAAAACCATAGAGAACTCAGG - Intergenic
1130585610 15:85179041-85179063 ATAAAAACCATAGAGAACTCAGG + Intergenic
1131186919 15:90282244-90282266 ATAAAAATCATAGAGAACTCAGG + Intronic
1131821644 15:96280010-96280032 ACAAAAAACATACAGTAGGATGG - Intergenic
1132201612 15:99958203-99958225 TTAAAAATTAAAGTGTAGGCAGG - Intergenic
1133146642 16:3791903-3791925 AGAAAATTCAGAGAGTAGGTAGG - Intronic
1133229284 16:4359065-4359087 TTAAAAATCATACTGTAGGCCGG - Intronic
1133274620 16:4629747-4629769 AAAAAAATCATACAGGCGGCTGG + Intronic
1133331060 16:4974360-4974382 ATAAAAATAAAAAACTAGGCAGG - Intronic
1133464282 16:6015248-6015270 TTAAAAATCCTAGAGTACTCTGG + Intergenic
1133670864 16:8018874-8018896 ATAAAACTGATAAATTAGGCTGG + Intergenic
1133831903 16:9331013-9331035 TTAAGAATCATTGAATAGGCTGG + Intergenic
1133908641 16:10044350-10044372 TTAAAAATGATATTGTAGGCCGG - Intronic
1134157913 16:11858986-11859008 ATAAAAAGTATAGTATAGGCCGG - Intergenic
1135063971 16:19293750-19293772 ATAAAAATTAAAAATTAGGCTGG - Intronic
1136624541 16:31454008-31454030 ATATAAATAATAAAGCAGGCCGG + Intergenic
1136986736 16:35113262-35113284 TTAAAAAACATGGAGTTGGCTGG + Intergenic
1137482439 16:48863839-48863861 ATAAAGATCAAGGAGGAGGCCGG - Intergenic
1138567285 16:57842834-57842856 ATAAATATCATAGAGCAGCCGGG + Intronic
1138570130 16:57865475-57865497 ATAATAATAATAAAATAGGCTGG + Intergenic
1138764250 16:59582315-59582337 TTAAAAACCATAGAAAAGGCTGG + Intergenic
1139080522 16:63513676-63513698 ATAAAAATCATACTATAGGCCGG + Intergenic
1139130939 16:64143837-64143859 ATGAAAATCAAAGATTAGGCCGG - Intergenic
1139611527 16:68062421-68062443 CTTAAGATCATATAGTAGGCCGG + Intronic
1139787454 16:69405341-69405363 AGAAAATTCAGGGAGTAGGCCGG - Intronic
1139809201 16:69598726-69598748 ATAAAAATGTCAGCGTAGGCCGG + Intronic
1140039487 16:71396695-71396717 ATAAAACTCAAAGGGTAGCCAGG + Intergenic
1140355245 16:74299688-74299710 ATAAAGATGATGGAGTAGGCCGG - Intronic
1140598862 16:76450444-76450466 TAAAAAATCACAGAGCAGGCTGG - Intronic
1140680635 16:77381505-77381527 ATTAAAATCAGAGAGTCGGCTGG + Intronic
1141218044 16:82043386-82043408 ATAAAAATCATATAGATGGCCGG + Intronic
1142981170 17:3672740-3672762 ATTAAAATTATAGACTAGGAAGG - Intronic
1143722856 17:8825376-8825398 AGAAGAATAATAGGGTAGGCAGG + Intronic
1143916625 17:10298451-10298473 ATAAAAATCATAGCTTTGCCAGG - Intronic
1144482481 17:15639348-15639370 ATAAAAATGAGAATGTAGGCTGG - Intronic
1144622342 17:16825459-16825481 ATAAAAAGCAGAGAGGCGGCCGG + Intergenic
1144799588 17:17916367-17916389 ATAAAAATCTTAAAATAGGCCGG - Intronic
1144884084 17:18447254-18447276 ATAAAAAGCAGAGAGGTGGCCGG - Intergenic
1144916201 17:18725683-18725705 ATAAAAATGAGAATGTAGGCTGG + Intronic
1145148147 17:20497123-20497145 ATAAAAAGCAGAGAGGTGGCCGG + Intergenic
1145743719 17:27297463-27297485 AAAAAAAAAAAAGAGTAGGCCGG - Intronic
1145805667 17:27727479-27727501 AAGAAAATCACAGAGAAGGCTGG - Intergenic
1145959275 17:28877451-28877473 ATAAAGTTCATAGAGCAAGCAGG - Intergenic
1146215239 17:30973759-30973781 ATAAAACTCTTAGAAGAGGCTGG - Intronic
1147255985 17:39182402-39182424 TCATAAATCAGAGAGTAGGCTGG + Intronic
1147308842 17:39582037-39582059 ATAATAATCATACTATAGGCAGG + Intergenic
1147470631 17:40656910-40656932 TTAAAAATCACAGTATAGGCTGG + Intronic
1147519377 17:41154829-41154851 ATAAAAATAATAGAAGAGGCCGG - Intergenic
1147576686 17:41605383-41605405 ATAAAAAGCAGAGAGGCGGCCGG + Intergenic
1148395381 17:47304043-47304065 ATAAAAATTAAAAAGTAGCCAGG - Intronic
1148932882 17:51141444-51141466 ATAAAAATAATAAAATAGGCCGG - Intergenic
1148937216 17:51173092-51173114 ATAAAAAGCATAGAATTGGCCGG - Intergenic
1149346604 17:55743464-55743486 AGAAAAATCATAGTGTTTGCAGG + Intergenic
1149905237 17:60520274-60520296 AAAAAAATCATTAAGGAGGCCGG + Intronic
1149965295 17:61156574-61156596 ATAAAAATAAAAGGGGAGGCAGG - Intronic
1150721406 17:67617207-67617229 TTAAAAACCAGAGAGTTGGCTGG + Intronic
1150826519 17:68480836-68480858 ATAAAAATCCTTGTGTTGGCTGG - Intergenic
1151599402 17:75097120-75097142 ATAAAAGTGACAGAGTAGGCTGG - Intronic
1151762970 17:76117165-76117187 ATAATAATAATAAAATAGGCCGG - Intronic
1151864978 17:76795496-76795518 AAAAAAATTATAAAGTATGCAGG + Intergenic
1152116854 17:78393354-78393376 ATAAGAATCAAAGTCTAGGCCGG - Intronic
1152187371 17:78866297-78866319 AAAAAAAACACAGAGGAGGCAGG - Intronic
1152801237 17:82331695-82331717 CTAAAAATCAGAGAGAGGGCAGG + Intronic
1154159592 18:11971394-11971416 TTAAACATCAAAAAGTAGGCCGG - Intergenic
1155185615 18:23384128-23384150 ATAAAAATTAAAAAGTAGCCAGG + Intronic
1155264330 18:24076274-24076296 AGAAAAACCACAGAGCAGGCCGG - Intronic
1155299264 18:24413895-24413917 AAAAAAATGATAGAATAGGGTGG - Intergenic
1155487855 18:26366084-26366106 ATAAAAATAAAATAATAGGCCGG - Intronic
1155881888 18:31159347-31159369 ATAAAAACCACATAGTAGGCCGG - Intronic
1155889709 18:31251791-31251813 ATAAAAATTATAGAGCAGTGAGG - Intergenic
1155996487 18:32336132-32336154 ATAAAAACCATACAGTAGGCCGG + Intronic
1156413018 18:36853952-36853974 ATAAAAAGCACACAGTGGGCCGG - Intronic
1156886069 18:42137966-42137988 ATAAAACTCATAGATGAGGATGG - Intergenic
1157246685 18:46061005-46061027 TAAAAAATCATACAGGAGGCTGG + Intronic
1157254759 18:46128854-46128876 TTAAAAATCAAACATTAGGCTGG - Intergenic
1157255202 18:46132590-46132612 ATAAAAAACATTGACCAGGCTGG + Intergenic
1159538850 18:69749642-69749664 ATAAAAATCAATGAGTTGGCCGG + Intronic
1159621506 18:70644337-70644359 ATAATAATTAAAGAGGAGGCCGG + Intronic
1160056894 18:75491756-75491778 ACAAAAGTCATTAAGTAGGCTGG + Intergenic
1161452065 19:4351874-4351896 AAAAAAAGAATAGAGTTGGCTGG + Intronic
1161634635 19:5379983-5380005 CTAAAAAGCAAAAAGTAGGCTGG + Intergenic
1162137777 19:8566461-8566483 TTAAAAAGCATAGACCAGGCCGG - Intronic
1162223229 19:9197394-9197416 ATAAAAACCAAAGAGTTGGCTGG - Intergenic
1162583269 19:11543482-11543504 ATAATAATAAAAGAGTGGGCCGG + Intronic
1163002539 19:14377001-14377023 ATAATAATAATAAATTAGGCTGG + Intergenic
1163505020 19:17700522-17700544 CTTAAAATCATAAAGCAGGCCGG - Intergenic
1163889678 19:19999828-19999850 ATAAAAATTATGGTGTAGGCTGG - Intronic
1163969490 19:20778394-20778416 TTAAAAATAATGCAGTAGGCCGG - Intronic
1163986526 19:20957507-20957529 ATAAAGACAATATAGTAGGCTGG - Intergenic
1163994395 19:21029668-21029690 ATAAAAATCAGAGTTTTGGCTGG + Intronic
1164042891 19:21509293-21509315 TAAAAAATCATGTAGTAGGCCGG - Intronic
1164869966 19:31634780-31634802 ATAAAAATGTTAGAATAAGCTGG + Intergenic
1164990931 19:32683261-32683283 AACAAAATCAAAGAGTAGACAGG - Intergenic
1165538175 19:36467887-36467909 ATAAAAATCAAAGTTTGGGCTGG + Intronic
1165639232 19:37370303-37370325 ATAATAATAATAAAATAGGCCGG + Intergenic
1165657492 19:37547221-37547243 TTAAAAATCTTAAATTAGGCTGG + Intronic
1165798647 19:38534305-38534327 ATAAAAATCACAGATGTGGCTGG - Intronic
1166027981 19:40106417-40106439 ATAAAAATCTCAGATTTGGCAGG + Intergenic
1166689876 19:44816019-44816041 ATAAAAATAAAAAAGTAGGCCGG + Intronic
1166780187 19:45338132-45338154 TTAAAAAAGCTAGAGTAGGCCGG + Intronic
1167122349 19:47525615-47525637 ATAAAACTTCTAGAGAAGGCCGG + Intronic
1167159680 19:47759017-47759039 ATAAAAATACTAAAGTAGCCAGG - Intergenic
1167219808 19:48191499-48191521 ATAAAAATAATAGCTAAGGCTGG - Intronic
1167320000 19:48791425-48791447 ATAAAAATAAAAAATTAGGCAGG + Intergenic
1167451301 19:49571280-49571302 TTAAAAATCAAAGAGTTTGCCGG - Intronic
1167469561 19:49667931-49667953 ATAAAAATCAGCTAGTATGCTGG - Intronic
1167682932 19:50936356-50936378 ATAAAAGAGAAAGAGTAGGCTGG - Intergenic
1167751530 19:51383329-51383351 AAATAAATGAAAGAGTAGGCTGG - Intronic
1167899876 19:52611995-52612017 AAAAAAATCATAGTGGAGCCCGG - Intronic
1167914541 19:52730095-52730117 ATAAAAAACATGATGTAGGCCGG + Intronic
1167928305 19:52841932-52841954 ACAGAAATCAAAGAGTTGGCTGG - Exonic
1168054732 19:53856509-53856531 ATAAAATTCTTAGAATAGGCTGG - Intergenic
1168081070 19:54010875-54010897 CTAAAAATAAAAGAGGAGGCTGG - Intronic
1168116972 19:54227779-54227801 GTAAAAATGATAGAGACGGCTGG - Intronic
1168656986 19:58137255-58137277 ATAAAAATCACAGCAGAGGCTGG + Intronic
925198055 2:1943338-1943360 ATTAAAAAAATAGAGAAGGCAGG + Intronic
925583852 2:5442877-5442899 ATAAAAAGGATAAAGTAGGCCGG - Intergenic
925975051 2:9136591-9136613 ATAAAAATGATAGCACAGGCCGG + Intergenic
928507000 2:31964398-31964420 ATAAAAATCACCGAGTAGGCCGG + Intronic
928507049 2:31964750-31964772 ATAAAAATCACTGAGTAGACAGG + Intronic
929293472 2:40219860-40219882 AAAAAAATCCTATAGTAGGGAGG - Intronic
929351840 2:40965669-40965691 ATAGAAAACAAAGAGTAGGCAGG - Intergenic
929467414 2:42157598-42157620 GTAAAAATCATAGTGTAGGCCGG - Intergenic
930366670 2:50447708-50447730 TTAAAAATCACATAGTAAGCAGG + Intronic
931537124 2:63291510-63291532 ATGAAAAACAAAGAGGAGGCTGG + Intronic
931592708 2:63902670-63902692 ATAAAAATAACTGATTAGGCCGG + Intronic
932020622 2:68082449-68082471 ATCAAAATAACATAGTAGGCAGG + Intronic
932242141 2:70165841-70165863 ATAAAAAACACAGTGTAGCCTGG + Intronic
932373441 2:71212748-71212770 ATAAAAATTAAAAAATAGGCTGG - Intronic
932507727 2:72252706-72252728 ATAAAAATCACAGATCAGGGAGG + Intronic
932515434 2:72343127-72343149 ATAAAAAACAAAAAGAAGGCTGG + Intronic
932766517 2:74474066-74474088 AAAAAAATCCAAGATTAGGCAGG - Intronic
934301491 2:91779191-91779213 ATAAAAATAAAAAATTAGGCTGG + Intergenic
934876250 2:97923790-97923812 ATAAAAAAGTTAGATTAGGCCGG + Intronic
935008036 2:99100931-99100953 AAAAAAAGCATAAATTAGGCTGG + Intronic
935008039 2:99100965-99100987 AAAAAAAGCATAAATTAGGCTGG + Intronic
935074605 2:99728733-99728755 ATAACAAACATTGATTAGGCAGG + Intronic
935162197 2:100538780-100538802 AAAAGTTTCATAGAGTAGGCTGG + Intergenic
935621321 2:105132541-105132563 ATAAAAATCTTAGAAGAGGCCGG + Intergenic
935747610 2:106202637-106202659 ATAAAACTCATAAAGTAGATGGG + Intergenic
935887881 2:107643429-107643451 CTAAAAATAAGAGAGTAGACTGG - Intergenic
936702936 2:115035590-115035612 ATTATAATCAAAGAGTAGGTTGG - Intronic
937397016 2:121546306-121546328 ATAGAAATCAAAGTGTAGGGGGG + Intronic
938395154 2:130940542-130940564 TGAAAATTCATGGAGTAGGCCGG + Intronic
938819392 2:134939760-134939782 TTAAAAATCATATGATAGGCCGG - Intronic
939028244 2:137039894-137039916 AGAAACACAATAGAGTAGGCAGG - Intronic
939145186 2:138405368-138405390 ATAAAAATAATAAAGATGGCAGG - Intergenic
940241154 2:151564447-151564469 ATAAAATGCCTAGAGTTGGCTGG - Intronic
940946183 2:159621142-159621164 AAACAAATCATAAAGTAGTCTGG + Intergenic
942067933 2:172289305-172289327 TTAAAAATCATGGTGTTGGCCGG - Intergenic
942112670 2:172698062-172698084 ATAAAAATTACACAGTAGACTGG - Intergenic
942188772 2:173449919-173449941 TTAAAAATTATATTGTAGGCCGG - Intergenic
942266931 2:174237451-174237473 ATAAAAATTACAGTATAGGCTGG + Intronic
942600715 2:177638293-177638315 GTAAAAAAAATATAGTAGGCTGG - Intronic
942892414 2:181007422-181007444 ATAAATATAAGAGAGTAGACTGG + Intronic
944047260 2:195427548-195427570 ACGAAAAACATAGCGTAGGCTGG + Intergenic
944807365 2:203295649-203295671 TTAGAAATAATAAAGTAGGCCGG + Intronic
944820407 2:203424553-203424575 ATAAAAATAATAAATTAGCCAGG - Intronic
944945227 2:204676648-204676670 AAAACAATCATAGAGTAGAATGG - Intronic
945421452 2:209642144-209642166 ATAAAAACCATAAAATGGGCTGG + Intronic
945492346 2:210471339-210471361 AGAAAAATCAAAGAAGAGGCTGG - Intronic
945494141 2:210489649-210489671 AAAAAAATCATAAAGTGGGGAGG + Intronic
945972796 2:216246510-216246532 ATTAAAAACAATGAGTAGGCCGG - Intergenic
946042675 2:216795956-216795978 ATGCCAATCATGGAGTAGGCTGG + Intergenic
946204563 2:218094280-218094302 ATGAAAAGCATACAGCAGGCAGG + Intergenic
946346252 2:219113031-219113053 CTTAAAATCATGGGGTAGGCAGG + Intronic
947969737 2:234313005-234313027 ATGAAAATCAGAAATTAGGCTGG - Intergenic
1168809979 20:698915-698937 TTAAGAATCATGGAGTTGGCCGG + Intergenic
1168814877 20:729402-729424 ATAATAATCATGGGTTAGGCCGG + Intergenic
1169148587 20:3271107-3271129 ATTAAAATAATAGAGGAGGCCGG - Intronic
1169332556 20:4728082-4728104 AAAGAAAACAAAGAGTAGGCAGG - Exonic
1169529327 20:6467230-6467252 TTTAAAATCATCGTGTAGGCTGG + Intergenic
1170383185 20:15784850-15784872 TTAAAAATCACGGAGTAGGCCGG + Intronic
1170646078 20:18196988-18197010 AAAAAAAACACACAGTAGGCTGG - Intergenic
1171079229 20:22161437-22161459 ATGAAAATCTTAGAGTAGACTGG - Intergenic
1171263796 20:23754078-23754100 TTAAAAATGATGGAGTAGCCAGG + Intergenic
1171564524 20:26168368-26168390 ATAAAAATGACATAATAGGCCGG + Intergenic
1172256002 20:33518241-33518263 ATTAAAATCAAAATGTAGGCAGG - Intronic
1172549417 20:35787473-35787495 ATAAAAATAAAAAAATAGGCTGG - Intronic
1172549456 20:35787765-35787787 ATAAAAATAAAAAAATAGGCTGG - Intronic
1172757779 20:37299236-37299258 AAAAAAATAATAAATTAGGCAGG - Intronic
1172913999 20:38430331-38430353 ATAAAAATAAAAAAATAGGCCGG + Intergenic
1173740417 20:45396247-45396269 AAAAAAATAATAAAATAGGCCGG - Intronic
1174329596 20:49807651-49807673 AAAAAAATCATAGTTTTGGCCGG - Intergenic
1174688436 20:52478583-52478605 ATAAAAAGCATAGAGCAGCTGGG + Intergenic
1174810070 20:53637927-53637949 TTAAAAACCAGAGAGTAGGCTGG - Intergenic
1174981380 20:55399185-55399207 ATAAAAAACATGTAGAAGGCAGG + Intergenic
1175526182 20:59635528-59635550 ATAAAAAGCAAGGAGCAGGCCGG - Intronic
1175560988 20:59931120-59931142 ATAAAAATAATAGCCTTGGCTGG + Intronic
1175647462 20:60687018-60687040 ATAAAAATCGAAGAGTTGGCCGG + Intergenic
1176766112 21:13020166-13020188 ATAAAAAGAATAGAGTAAGCCGG + Intergenic
1177590821 21:23164725-23164747 GTAAAAAACATAAAATAGGCTGG + Intergenic
1178094622 21:29200054-29200076 ATAAAAGTCTTAGAAGAGGCCGG - Intronic
1178257135 21:31064357-31064379 ATAAAAATCATAGCCTGGGCTGG - Intergenic
1178614451 21:34118809-34118831 TTAAGAAACATGGAGTAGGCTGG - Intronic
1178720295 21:35002722-35002744 ATAAAAATAAATAAGTAGGCCGG - Intronic
1180133083 21:45840154-45840176 GTAAAAATGTTACAGTAGGCTGG + Intronic
1180645110 22:17332474-17332496 ATAAAAATCACAGAGGCGACAGG + Intergenic
1180814947 22:18783532-18783554 ATAAAAATAAAAAATTAGGCTGG - Intergenic
1181201135 22:21217868-21217890 ATAAAAATAAAAAATTAGGCTGG - Intronic
1181700606 22:24619099-24619121 ATAAAAATAAAAAATTAGGCTGG + Intronic
1181809962 22:25397947-25397969 ATAATAATAATAAAATAGGCTGG + Intronic
1181999346 22:26907593-26907615 AAAAAAATCAAAAAATAGGCTGG - Intergenic
1182105184 22:27684048-27684070 ATAAAAATAATAAAATAGGCCGG + Intergenic
1182127807 22:27828896-27828918 ATTAAAATCAGAGATTCGGCAGG + Intergenic
1182308962 22:29391149-29391171 ATAAAAATAAAAAAGTAGTCAGG + Intronic
1182553390 22:31114668-31114690 ATAAAAATAATAGGCTTGGCCGG + Intronic
1182602265 22:31475453-31475475 TTAAAATTCATCGAGTGGGCCGG + Intronic
1182638019 22:31744427-31744449 ACAAAAATAAAAAAGTAGGCCGG - Intronic
1183251163 22:36731493-36731515 ATAGAAATCAGGGAGTTGGCAGG - Intergenic
1183491570 22:38119538-38119560 ATAAAAAGCACAAACTAGGCTGG + Intronic
1183840883 22:40500223-40500245 AAAAAAATCATAGACTGGGCCGG - Intronic
1184313160 22:43661820-43661842 ATATAGTTCATAGAGTTGGCTGG + Intronic
1184622682 22:45694353-45694375 AAAAAAATCTTAATGTAGGCTGG + Intronic
1203225780 22_KI270731v1_random:77563-77585 ATAAAAATAAAAAATTAGGCTGG + Intergenic
1203265048 22_KI270734v1_random:9221-9243 ATAAAAATAAAAAATTAGGCTGG - Intergenic
949675459 3:6448037-6448059 ATAAAAATCCCAGAGTCGGCTGG - Intergenic
950201251 3:11045876-11045898 ATAAGAATCAGAGAGTGTGCTGG + Intergenic
950532645 3:13561428-13561450 AGAAAAATGATAGAGGTGGCGGG - Intronic
950811772 3:15656097-15656119 ATAATAATAACAAAGTAGGCTGG - Intergenic
950974402 3:17225681-17225703 ATAAAAATGAAAAAGTAGCCAGG + Intronic
951206023 3:19926654-19926676 ATAAAAATAAAAAAGCAGGCTGG - Intronic
951216699 3:20032011-20032033 ATAAAAATGACAGTGTTGGCTGG - Intergenic
951872462 3:27380010-27380032 ATTAAAAGAACAGAGTAGGCCGG + Intronic
951906586 3:27713320-27713342 ATAAAAATCAAAGGGAATGCGGG + Intergenic
952069593 3:29618196-29618218 AAAAATAGCACAGAGTAGGCCGG + Intronic
952338462 3:32424997-32425019 AGAAAAAACATAGAAGAGGCAGG + Intronic
952582797 3:34854153-34854175 ATTAAAATAATAAAATAGGCCGG - Intergenic
952764416 3:36942883-36942905 AAAAAAAACATAGAATGGGCCGG + Intronic
952999722 3:38921374-38921396 ATCAGAATCATAGGCTAGGCTGG - Intronic
953028731 3:39161868-39161890 ACAAAAAACACAGAGTAGTCTGG + Intergenic
953380701 3:42470209-42470231 ATAAAAACCAGACAGCAGGCTGG + Intergenic
953400343 3:42608827-42608849 AGAAATATCAAATAGTAGGCTGG + Intronic
954721694 3:52569504-52569526 TTAAAAATCATATTGAAGGCCGG - Intronic
954774115 3:53000156-53000178 AAAAAAATGTAAGAGTAGGCTGG - Intronic
955305628 3:57828253-57828275 ATAAAAATGTTAAACTAGGCTGG - Intronic
956308285 3:67850512-67850534 ATAAAAATAAAATAGTTGGCCGG - Intergenic
956948813 3:74256399-74256421 ACAAAAATCAAATAGAAGGCTGG + Intergenic
957157325 3:76561736-76561758 ATAACAGTTAAAGAGTAGGCAGG - Intronic
958001130 3:87750286-87750308 AAAAAAATCATATTGCAGGCTGG + Intergenic
958614570 3:96475056-96475078 ATTAAAATAATTGTGTAGGCTGG + Intergenic
959271881 3:104221848-104221870 ATAAAAATCCTAGAAGAGCCAGG - Intergenic
959801886 3:110504882-110504904 ATAATAATAATAAAGTAGCCCGG + Intergenic
960217868 3:115064747-115064769 TTAAAATTCAGAGAGAAGGCCGG - Intronic
960620357 3:119631103-119631125 ATGAAAATCATATTGTCGGCCGG + Intergenic
961198084 3:125020435-125020457 ATAAAACATAAAGAGTAGGCCGG + Intronic
961316925 3:126044597-126044619 ATTAAAATCATACAGAGGGCCGG + Intronic
961528193 3:127521631-127521653 ATAGAAAACAGACAGTAGGCTGG - Intergenic
961702593 3:128757953-128757975 ATAAAAAAAATAAAATAGGCTGG - Intronic
962333922 3:134508423-134508445 TTAAAAATCATAATTTAGGCAGG + Intronic
962444864 3:135455251-135455273 ATGAAAATCATGGTGTCGGCAGG + Intergenic
963088233 3:141457996-141458018 ATAAAAACCATTGAGTGGCCAGG - Intergenic
963185201 3:142407623-142407645 ATAAAAACAAAAAAGTAGGCCGG - Intronic
963421218 3:145062891-145062913 ATAAAAATCACAGAGTGTGTGGG - Intergenic
963891414 3:150639946-150639968 ATTAGAATCTTAGAGGAGGCAGG + Intergenic
964330717 3:155599298-155599320 AAAAAGAGAATAGAGTAGGCTGG + Intronic
964349013 3:155784224-155784246 AAAAAAAGCATAAACTAGGCTGG - Intronic
964827039 3:160839967-160839989 ATAAAAGTCATGGAGTAGGGAGG + Intronic
965107249 3:164372759-164372781 AAAAAATACATAAAGTAGGCTGG + Intergenic
965169089 3:165237184-165237206 ATAAAAATCCTAGAAGAGGCTGG - Intergenic
965997346 3:174900404-174900426 ATAAAAACAATAGAGTACACTGG + Intronic
966168718 3:177052805-177052827 ATAAAAATTTTAAACTAGGCTGG + Intronic
966367190 3:179202364-179202386 ATAAAAATCACGAAATAGGCTGG - Intronic
966514471 3:180802584-180802606 AAAAAAATCACAGAGTAGAATGG + Intronic
966790948 3:183668910-183668932 AAAAAAATCTTAGAGTAGGAAGG + Intronic
966843712 3:184109890-184109912 ATAAAAATAATAGACCAGCCTGG + Intergenic
967974250 3:195023098-195023120 ATAAAAATGATAAAATAGGCCGG - Intergenic
967993232 3:195147271-195147293 ATAAAAAACTGAGAATAGGCTGG + Intronic
968333669 3:197894087-197894109 ATTAAAATCCCAAAGTAGGCAGG + Intronic
968352060 3:198066078-198066100 AGAAAAAACATATGGTAGGCAGG - Intergenic
968864758 4:3201230-3201252 ATAACATTAATAGATTAGGCTGG + Intronic
968929603 4:3571762-3571784 ATAAAAATCAAAAATTAGCCAGG - Intergenic
970736677 4:19178441-19178463 ACAAAAATCAGACTGTAGGCTGG + Intergenic
970779309 4:19716807-19716829 ATTAAGCTGATAGAGTAGGCAGG - Intergenic
971038980 4:22729305-22729327 ATAAAAAGCATAAAGTAAGATGG - Intergenic
971288360 4:25311856-25311878 TTAAAAATCAAAGAATAGCCGGG - Intergenic
971779357 4:31011612-31011634 ATGAAAATCACAGAAAAGGCTGG + Intronic
971946934 4:33290480-33290502 ACAAAAATCGTATAGTATGCTGG + Intergenic
972125236 4:35757320-35757342 ATACAAGTCCTAGAGTAGGGAGG + Intergenic
972355452 4:38276164-38276186 ATAAAAAACAGACAGCAGGCTGG - Intergenic
972893993 4:43596399-43596421 ATAAAATTCTAAGAGCAGGCCGG + Intergenic
973981177 4:56309555-56309577 ACAAAAATTATAAAATAGGCTGG + Intronic
974105681 4:57467148-57467170 ATAAGAATCATATAATGGGCAGG - Intergenic
974460017 4:62175141-62175163 ATAAAAGTCACAGAATAGACAGG - Intergenic
974736216 4:65936371-65936393 ATAAAAACCCTAGAAGAGGCTGG - Intergenic
975575652 4:75860050-75860072 ATAAAAAGTATAAAATAGGCTGG + Exonic
976006182 4:80432816-80432838 ATAAAAAATAGAGTGTAGGCCGG - Intronic
976094703 4:81496016-81496038 ATAAAGATCATAGAGGATGTCGG + Intronic
976291882 4:83427356-83427378 ATAAAAAGCATATAATAGGCCGG + Intronic
976737007 4:88320485-88320507 AAAAACCTCATAAAGTAGGCAGG + Intergenic
977095797 4:92742406-92742428 AGAAAAATCCTGGGGTAGGCTGG - Intronic
977180314 4:93866020-93866042 ATAAAAATAATAGATGAGTCTGG + Intergenic
977277261 4:94993030-94993052 ATAAAAAACTTAAATTAGGCAGG - Intronic
977562170 4:98543714-98543736 TTAAAAATTCTAAAGTAGGCTGG - Intronic
977729002 4:100329762-100329784 ATAAAAATTATGGAGTAAACTGG + Intergenic
977821303 4:101475404-101475426 ATAAACATCATGGAGGAGGGAGG + Intronic
978039290 4:104039490-104039512 ACAAAAATCTTTTAGTAGGCAGG + Intergenic
978161860 4:105558128-105558150 ATAAAGTTCATACAGTAGGGTGG - Intronic
979321450 4:119329837-119329859 ATAACAATGATGAAGTAGGCTGG - Intergenic
979924879 4:126549445-126549467 AAAAAAATCATAGAGTAGGGAGG + Intergenic
980921620 4:139092063-139092085 TTAAAAATAATAAAATAGGCCGG + Intronic
980931884 4:139189773-139189795 GTCAAAATTATAAAGTAGGCTGG - Intergenic
981523515 4:145689906-145689928 ATAAAAATCCTAGAAGAGGCTGG + Intronic
981946524 4:150351391-150351413 ATTAAAAGTATACAGTAGGCCGG + Intronic
982255336 4:153445821-153445843 TAAAAAATTATAGACTAGGCCGG + Intergenic
982825246 4:159996320-159996342 ATAAAAATGATAAAGGAGGCCGG + Intergenic
982937254 4:161496554-161496576 CTTAAATTCATAGAGCAGGCTGG - Intronic
983120059 4:163872746-163872768 ATAAAAATGATGAAGTCGGCCGG + Intronic
983497226 4:168457053-168457075 ATAAAAATTAAAAATTAGGCAGG + Intronic
983570092 4:169197296-169197318 ATAAAAGTTATAGAATTGGCTGG - Intronic
983655752 4:170082111-170082133 ATTACAATCATAGAGTATTCTGG - Intronic
983903092 4:173157814-173157836 TTAAAAATAAAAGAATAGGCTGG + Intergenic
984677564 4:182567732-182567754 AAAAAAAAAATAGAGTAGGGTGG - Intronic
984923636 4:184787452-184787474 ATGAAAATGATAGACTAGGAAGG + Intronic
985010043 4:185573147-185573169 ATAAAAATAAAAAATTAGGCAGG - Intergenic
985318589 4:188684248-188684270 TTAAAAACAATATAGTAGGCTGG + Intergenic
1202769215 4_GL000008v2_random:185985-186007 TTAAAACTCAGAAAGTAGGCTGG + Intergenic
986234014 5:5890923-5890945 GAAAAAAAAATAGAGTAGGCAGG - Intergenic
986784685 5:11103372-11103394 ATAAAAACCTGAAAGTAGGCTGG + Intronic
986861416 5:11931183-11931205 ATATAAAACATAAAGCAGGCAGG + Intergenic
987222847 5:15808120-15808142 AAAAAAATCATAAATTAGCCAGG - Intronic
987810880 5:22834310-22834332 ATAATAATTATAGAGGAGACTGG + Intronic
987939046 5:24508813-24508835 TTTAAAATTATAAAGTAGGCTGG - Intronic
988246395 5:28688027-28688049 ATAAAAATAAAAAAGTAGCCAGG - Intergenic
988942710 5:36162226-36162248 AGAAAAATCAGAGAGCAGCCAGG - Intronic
989049306 5:37303647-37303669 ATAACAATAATTTAGTAGGCTGG + Intronic
989184654 5:38611881-38611903 ATAAAAATTATAATTTAGGCCGG + Intergenic
989509767 5:42271910-42271932 ATCAAAAAGAGAGAGTAGGCCGG - Intergenic
989808389 5:45640825-45640847 TTAAAAATCATAGTTAAGGCTGG - Intronic
990087221 5:51993754-51993776 CAATAAATCTTAGAGTAGGCTGG + Intergenic
990190225 5:53251478-53251500 ATCAAAAGCATAGTTTAGGCTGG + Intergenic
990249284 5:53896328-53896350 ATAAAAATGATTAAATAGGCTGG - Intronic
990952004 5:61307584-61307606 ATAGCAATAATAGAGTAGCCTGG + Intergenic
990960046 5:61384759-61384781 GTAAAAATCTTGGAGGAGGCCGG + Intronic
990963406 5:61418553-61418575 ATAAAAATCATAGAGTAGGCCGG - Intronic
990972284 5:61521745-61521767 AAAAAGATCATGGAGTAGGATGG + Intronic
992220700 5:74569383-74569405 ATAAAAATCCTACAAGAGGCCGG - Intergenic
992523394 5:77580657-77580679 ATAAAAAATAAAAAGTAGGCTGG + Intronic
992917887 5:81478319-81478341 ATAAAAATAAAAAATTAGGCAGG - Intronic
993103251 5:83567593-83567615 ATAAAAATCAAAGAGTTGCCGGG - Intronic
994054806 5:95403178-95403200 ATCAAAATTTTAGGGTAGGCGGG - Intronic
994099179 5:95876021-95876043 ATAAAAATAAAAGTGTTGGCTGG + Intergenic
994137022 5:96300204-96300226 ATAAAAATACTAGAGAAAGCAGG - Intergenic
994658109 5:102619567-102619589 ATTAAAATCACAGAAGAGGCTGG + Intergenic
994825031 5:104702319-104702341 ATAAAAATATTAGAATAGGAAGG - Intergenic
995089574 5:108158066-108158088 GTAAAAATCCTAGAGAAGACTGG + Intronic
995588127 5:113670661-113670683 ATAAAAATAAGAAAGTAGCCAGG + Intergenic
995609135 5:113890269-113890291 TTAAAAGTCATAGAATAGGCTGG + Intergenic
995669925 5:114591043-114591065 ATAAAAATCATAGAGAACGTAGG - Intergenic
996380067 5:122854210-122854232 AAAATAATCATAGTGTAGGCCGG + Intronic
997062102 5:130518668-130518690 TTAAAAGGCATAGAGTGGGCTGG - Intergenic
997179077 5:131809510-131809532 ATAAAAACCAAAGAACAGGCTGG + Intronic
997722658 5:136092089-136092111 ATAAAAATAATAGAACAGGCCGG - Intergenic
997722712 5:136092524-136092546 ATAAAAATAATAGAACAGGCCGG - Intergenic
998706197 5:144764223-144764245 ATAAAACTCAATCAGTAGGCAGG - Intergenic
998842366 5:146268536-146268558 TTAGAAATGATAGAGTAGGCCGG - Intronic
999686560 5:154108337-154108359 ATAAGAATGATAGTGTAGGCCGG + Intronic
999782805 5:154864162-154864184 TTAGAAATTATAGAGTTGGCCGG + Intronic
999929363 5:156413635-156413657 ATAAAAATTAAAAAGTAGCCAGG - Intronic
1000093953 5:157954476-157954498 ATAAAAACCATATTGTTGGCTGG + Intergenic
1000272560 5:159700473-159700495 AAAAAGATCACAGAGAAGGCAGG - Intergenic
1000419194 5:161018729-161018751 ATCAGAATCAGAGAGTAGGATGG + Intergenic
1000719424 5:164688345-164688367 AAAAAACTCATAAATTAGGCTGG - Intergenic
1001107460 5:168867260-168867282 AGAAAAATTCTAGAGTAGGCCGG + Intronic
1001192774 5:169646043-169646065 ATAAAAACCCTAGAAGAGGCTGG - Intronic
1001296539 5:170503091-170503113 AGAAAAATGAGAGAGCAGGCCGG + Intronic
1002117875 5:176978395-176978417 ATAAAAATCATTTGGTAGCCCGG + Intronic
1002143134 5:177157069-177157091 TTAAAAATCAAAGTATAGGCCGG + Intronic
1002490605 5:179573816-179573838 TAAAAAATCACAAAGTAGGCCGG - Intronic
1002612103 5:180426954-180426976 ATAAGAATCAAAGAGGAGCCGGG - Intergenic
1002669694 5:180856656-180856678 ATAAAAATGACAGAGGCGGCCGG + Intronic
1003053637 6:2800911-2800933 AGAATAATCATAGAATATGCTGG - Intergenic
1003323057 6:5069773-5069795 ATAAAATACATAGTGTAGGCCGG - Intergenic
1003889751 6:10553595-10553617 AAAAAAATCATTAAATAGGCCGG + Intronic
1004115439 6:12762252-12762274 ATAAAATTCATAGTTTAGGAGGG - Intronic
1004509534 6:16274108-16274130 ACAAAAATCTTAGAGGAGGCTGG - Intronic
1004509756 6:16275907-16275929 ATAAAAATTAAAAAGTAGTCAGG + Intronic
1004643301 6:17536117-17536139 AGAAAAAACAGAGAGAAGGCTGG - Intronic
1004649464 6:17594691-17594713 AAAAAAATAACAGAGTAGGCTGG - Intergenic
1004992513 6:21154691-21154713 ATTAAAATACCAGAGTAGGCTGG + Intronic
1005597452 6:27392938-27392960 ATACAATTCTTAGAATAGGCAGG + Intronic
1006137381 6:31903331-31903353 ATAAAAATCATGCAATAGGGAGG + Intronic
1006475842 6:34253173-34253195 TTAAAAATCAAAAAGTAGGCTGG + Intergenic
1006526638 6:34611536-34611558 ATTAAAGTAATACAGTAGGCAGG - Intronic
1006585582 6:35108745-35108767 ATTAAAATCATACACTAGCCAGG + Intergenic
1006658282 6:35616014-35616036 TTCAAAATAGTAGAGTAGGCTGG + Intronic
1006830620 6:36965707-36965729 GGAAAAAACATAGAGTAGACCGG - Intergenic
1006846690 6:37067043-37067065 ATAAAAATAAAAGAGCAGTCAGG + Intergenic
1007458471 6:41998972-41998994 ATAAAAAGCATAGACCAGCCAGG - Intronic
1007567109 6:42859939-42859961 ATAAATATCAATGAGTAGGCCGG - Intronic
1007576461 6:42928281-42928303 ATAAAAAATAAAGAGGAGGCCGG - Intergenic
1008075509 6:47141307-47141329 TTAGAAATCTTAAAGTAGGCTGG + Intergenic
1008151475 6:47957219-47957241 ATAAAATTCAAAGAGTATGATGG + Intronic
1008565387 6:52762808-52762830 AGAAATATCCTAGAGTGGGCAGG + Intronic
1008621681 6:53277262-53277284 AGAAAAATCAGATAGAAGGCAGG - Intronic
1008747066 6:54684755-54684777 ATAAAAAGGATAGATTTGGCCGG - Intergenic
1009579358 6:65512194-65512216 ATAAAAATTACATTGTAGGCCGG + Intronic
1010276541 6:73973948-73973970 AGAAAAATCAGGTAGTAGGCGGG - Intergenic
1011685756 6:89822165-89822187 ATAAAAATCTAAGACTGGGCAGG + Intergenic
1012003245 6:93680804-93680826 ATAAGAAACATAAAGCAGGCTGG - Intergenic
1012458069 6:99429145-99429167 TTAAGAATCAAAGAGTAGGCTGG - Intergenic
1013502257 6:110764652-110764674 ATAAAATTTTTAGAGAAGGCCGG + Intronic
1013730869 6:113165460-113165482 TTAAAAAGCACACAGTAGGCTGG + Intergenic
1014130115 6:117821419-117821441 ATAAAAATTTTAGTTTAGGCCGG + Intergenic
1014215626 6:118750148-118750170 ATAGAAATAATAATGTAGGCTGG - Intergenic
1014684961 6:124485670-124485692 ATAAAAATCATAGGGTCAGAAGG - Intronic
1017353096 6:153467617-153467639 AGAAAAAGAATAAAGTAGGCCGG - Intergenic
1018608146 6:165620742-165620764 ACAAAAAGGATAGAGAAGGCTGG + Intronic
1019792003 7:3020749-3020771 ATAAAAATCACAGAGTAGAAAGG + Intronic
1021016493 7:15541414-15541436 ATAAAAATAATGCATTAGGCTGG - Intronic
1021191462 7:17624716-17624738 ATAAATAACATAGAGCAGGATGG + Intergenic
1021531650 7:21653170-21653192 CTAAAAAGAATAGATTAGGCTGG - Intronic
1021779021 7:24083627-24083649 ATAGATATCACAGAGTAGGAGGG + Intergenic
1022110525 7:27227732-27227754 ATAAAAATAATTGAGTCTGCCGG + Intergenic
1022448100 7:30486340-30486362 ACTAAAATCATAGTGTTGGCAGG - Intergenic
1022462399 7:30622802-30622824 ATATAAACAATAGAGAAGGCCGG + Intronic
1022657987 7:32338705-32338727 ACAAAAACCAAAGAGAAGGCCGG + Intergenic
1023959519 7:44914682-44914704 ATAAAAATAGTAGAGTGGGCTGG + Intergenic
1024519927 7:50296772-50296794 ATGAAAACCAGAGAGAAGGCAGG + Intergenic
1024883262 7:54113535-54113557 ATGAAAATCAGACAGGAGGCAGG - Intergenic
1024886161 7:54145078-54145100 TTAAAAATTTTAGATTAGGCCGG - Intergenic
1026087120 7:67271562-67271584 ATAAAAATCATAAGGTGGCCGGG + Intergenic
1026090781 7:67298884-67298906 ATTAAAAAAATAAAGTAGGCTGG - Intergenic
1026151113 7:67788824-67788846 ATAAAAATCCTGGGGTTGGCTGG + Intergenic
1026395493 7:69949101-69949123 ATAAAAATCAAGAAATAGGCTGG - Intronic
1026540995 7:71279931-71279953 ACAAAAATCATTTAGTGGGCCGG - Intronic
1026689977 7:72543137-72543159 ATAAAAATCATAAGGTGGCCGGG - Intergenic
1026745502 7:73008292-73008314 ATAAAACTCTTAAAGTGGGCTGG + Intergenic
1026749154 7:73036232-73036254 ATAAAACTCTTAAAGTGGGCTGG + Intergenic
1026752802 7:73064377-73064399 ATAAAACTCTTAAAGTGGGCTGG + Intergenic
1026756453 7:73092503-73092525 ATAAAACTCTTAAAGTGGGCTGG + Intergenic
1026834693 7:73630587-73630609 TTGAAAATCAAAGGGTAGGCCGG - Intergenic
1027031614 7:74892966-74892988 ATAAAACTCTTAAAGTGGGCTGG + Intergenic
1027090952 7:75300919-75300941 ATAAAACTCTTAAAGTGGGCTGG - Intergenic
1027094597 7:75328891-75328913 ATAAAACTCTTAAAGTGGGCTGG - Intergenic
1027098238 7:75356818-75356840 ATAAAACTCTTAAAGTGGGCTGG - Intergenic
1027324744 7:77038789-77038811 ATAAAACTCTTAAAGTGGGCTGG + Intergenic
1027339893 7:77195640-77195662 ATAAAATTTATTCAGTAGGCTGG - Exonic
1027441189 7:78220688-78220710 AGAAAAATAATAGAGTGGACTGG + Intronic
1027671135 7:81100818-81100840 TTAAAAATAATAAAATAGGCTGG - Intergenic
1028218090 7:88160160-88160182 ATAAAAATAATAAAGTACCCAGG + Intronic
1028607076 7:92666544-92666566 ATAAAAATCAGAGATTTGACCGG - Intronic
1029475670 7:100782625-100782647 ATAAAAGTTCTAGAGCAGGCCGG - Intronic
1029787550 7:102807760-102807782 AAAAAAAATACAGAGTAGGCTGG + Intronic
1030289671 7:107859486-107859508 TTAAAAATCATAGAATTGGTTGG + Intergenic
1030660123 7:112208973-112208995 ATAAAAATCAAATCATAGGCCGG - Intronic
1030693334 7:112557361-112557383 ATAAAAATAATACAGTGGGCAGG - Intergenic
1030774613 7:113518545-113518567 ATAAGAATCAGAGAGTAGAATGG + Intergenic
1031020465 7:116622139-116622161 AAAAAAAACATAGTGTAGACAGG + Intergenic
1031629241 7:124026525-124026547 AAAAAAATCAAAGATTAGCCAGG - Intergenic
1032105522 7:129025827-129025849 ATAAAAATCCCAATGTAGGCTGG + Intronic
1032282816 7:130518705-130518727 ATAAAAAAGAGTGAGTAGGCTGG + Intronic
1032314240 7:130819964-130819986 ATAAAAAAGCTAGAGTGGGCCGG - Intergenic
1032827935 7:135590408-135590430 GTAAAAATAATATAGCAGGCTGG - Intronic
1032931084 7:136671784-136671806 ATAAAAATAATAGAGGAAGAAGG - Intergenic
1033347376 7:140536054-140536076 AAGAAATTCATAGAGAAGGCCGG + Intronic
1034060252 7:148080767-148080789 ATCAAAATTATAGAGCAGGGGGG + Intronic
1034327326 7:150248364-150248386 AAAAAAAAAAAAGAGTAGGCCGG + Intronic
1034642034 7:152611794-152611816 ATAAAAATTAAAAACTAGGCCGG - Intergenic
1034765883 7:153721085-153721107 AAAAAAAAAAAAGAGTAGGCCGG - Intergenic
1035697146 8:1606979-1607001 ATAAAACTCATACAGGAGGCCGG - Intronic
1035738663 8:1908526-1908548 TTAAAAATCAAAGTGTGGGCCGG - Intronic
1036063933 8:5357057-5357079 ATATAAATTATAGAAAAGGCTGG - Intergenic
1037185549 8:16058317-16058339 ATAGAAATCTTTGAGTGGGCTGG + Intergenic
1037282855 8:17262764-17262786 TTAAAAATTATATTGTAGGCCGG + Intronic
1037386255 8:18345507-18345529 ATAAAAAGCAGAGAGTAGAATGG + Intergenic
1037645114 8:20786119-20786141 TGATAAATAATAGAGTAGGCTGG + Intergenic
1037958006 8:23073686-23073708 AATAAAATAATAAAGTAGGCCGG - Intergenic
1038020157 8:23545838-23545860 ATAAAAATAAAAAAATAGGCCGG + Intronic
1038142351 8:24860157-24860179 ATAAAAGACATGGACTAGGCTGG + Intergenic
1038190722 8:25317905-25317927 ATTAAAACTAAAGAGTAGGCTGG - Intronic
1038246758 8:25865095-25865117 ATAAGAATAATTGAGAAGGCCGG - Intronic
1038533542 8:28337885-28337907 ATAAAAATGGAAGTGTAGGCCGG - Intronic
1038624176 8:29174256-29174278 ATTAAAATCATAGAGTAAATAGG - Intronic
1039381525 8:37090228-37090250 ATAAAAATCATGTTTTAGGCTGG + Intergenic
1039653666 8:39374346-39374368 TTAAAAATGTTAGAGTAGGCTGG + Intergenic
1039958492 8:42225574-42225596 ATGAAAATAACAAAGTAGGCCGG - Intergenic
1040615735 8:49036518-49036540 ATAAAAATCCTGGATGAGGCCGG + Intergenic
1041465492 8:58154043-58154065 ATAAAAATAACAGAGTTGGCTGG - Intronic
1041913202 8:63112076-63112098 ATAAAAATCATTTAGCTGGCCGG + Intergenic
1042133485 8:65612064-65612086 ATAAAAATGAAAGTGTAGGCCGG - Intronic
1042455597 8:68998807-68998829 ATAATAATAATAAAGCAGGCTGG - Intergenic
1042495362 8:69449759-69449781 CTAAAAAGCATTGAGAAGGCTGG - Intergenic
1043993722 8:86787464-86787486 ATAAAAATCATCCATTAGGGAGG - Intergenic
1044420990 8:91995623-91995645 ACAAAAATCAAAAAGTTGGCTGG + Intronic
1045460628 8:102422386-102422408 ACAAAAAGCAGAGAGAAGGCAGG + Intergenic
1045512288 8:102821455-102821477 AAAAACACCACAGAGTAGGCAGG + Intergenic
1045869363 8:106907581-106907603 GTAATAATAATAGAATAGGCTGG - Intergenic
1046804955 8:118469857-118469879 ATAAAAATTATAGTACAGGCTGG - Intronic
1047992960 8:130305668-130305690 ATAAAAATGAATGAATAGGCTGG - Intronic
1048367456 8:133750758-133750780 ACAAGAATTTTAGAGTAGGCCGG - Intergenic
1048747045 8:137625837-137625859 ATAAACATCACAGGGAAGGCAGG + Intergenic
1049836157 8:144736786-144736808 TTAACAATAATAAAGTAGGCCGG - Intronic
1050247892 9:3710428-3710450 ATAAAAATCTTATAATAGGCTGG - Intergenic
1050437528 9:5626549-5626571 AAAAAAATCACACAGGAGGCTGG + Intergenic
1050532946 9:6606774-6606796 ATAAAAAATACTGAGTAGGCCGG + Intronic
1050705515 9:8392227-8392249 ATAAAAATAAAAAATTAGGCTGG + Intronic
1050881976 9:10712910-10712932 AAGAAAAACATAGAGTATGCTGG + Intergenic
1051424354 9:16918661-16918683 AAAAAGATGATAAAGTAGGCCGG + Intergenic
1051600470 9:18867580-18867602 AAAAGAATCATTGAGTAGGATGG - Intronic
1052874183 9:33540856-33540878 AGAAAAAACATATGGTAGGCAGG + Intronic
1053174508 9:35912282-35912304 ATAAAAATAATAAAATAGGAAGG - Intergenic
1053247095 9:36543466-36543488 ATAATAATAATAAAATAGGCCGG + Intergenic
1053247246 9:36544637-36544659 CTAAAAATAATAAAATAGGCCGG - Intergenic
1053460233 9:38263088-38263110 CTAACAATAAGAGAGTAGGCTGG + Intergenic
1053501863 9:38603487-38603509 AGAAAAAACATATGGTAGGCAGG - Intergenic
1054460677 9:65460709-65460731 ATAAAAATCAAAAATTAGCCAGG + Intergenic
1054774510 9:69113791-69113813 TTAAAAAAGATAGAGGAGGCTGG - Intergenic
1055812925 9:80171746-80171768 ATAGAAATAAAAGAGTAGCCAGG + Intergenic
1055844412 9:80544123-80544145 ATTAAAATCAAAGAATTGGCAGG - Intergenic
1055941588 9:81655366-81655388 ATAAAAAAAATAAAGAAGGCTGG + Intronic
1056027311 9:82512368-82512390 AGAAAAATCATATAGGAGGAGGG + Intergenic
1056912996 9:90720271-90720293 ATAAGAATGATACAGTGGGCTGG + Intergenic
1057111139 9:92472361-92472383 ATAAAAATAAAAAAATAGGCTGG + Intronic
1057564180 9:96153650-96153672 ATAAAAATAATTAATTAGGCCGG - Intergenic
1057581570 9:96291658-96291680 ATAAAAATGCTTCAGTAGGCTGG + Intronic
1057681242 9:97187783-97187805 AGAAAAAACATATGGTAGGCAGG - Intergenic
1058030219 9:100187814-100187836 AAAGAAATCATAGATGAGGCTGG - Intronic
1058853009 9:109031517-109031539 AAAGAAATCATATAGTAGGTAGG - Intronic
1058902308 9:109452715-109452737 ATAAAAATAAAAAAGTAGTCAGG - Intronic
1059481365 9:114593157-114593179 ACAGAAAGCATAGAGGAGGCAGG + Intronic
1059633186 9:116147010-116147032 ATAAAACACAGAGGGTAGGCCGG + Intergenic
1059659160 9:116384291-116384313 ATAATAATAATAAAGTAGCCAGG + Intronic
1059957024 9:119527135-119527157 ATAAAAATCTTACAGTTGGAAGG + Intergenic
1060051387 9:120380945-120380967 GTTAAAATCAAGGAGTAGGCAGG + Intergenic
1060085594 9:120697377-120697399 ATAAAAGTCATAGAATAGACTGG - Intronic
1060608290 9:124937784-124937806 ATAAGAAACATATTGTAGGCTGG + Intronic
1060667608 9:125441829-125441851 ATAAAAATCAGAGATGGGGCCGG + Intronic
1060924040 9:127443141-127443163 ATTAAAAGCATAGTATAGGCTGG + Intronic
1061057299 9:128231097-128231119 ATAAAAATCACACAGACGGCAGG - Intronic
1062215636 9:135388180-135388202 ATAAAAAGCATTTAGGAGGCCGG + Intergenic
1062602721 9:137325791-137325813 ATAAAACTCTTAGAAGAGGCTGG + Intronic
1062604443 9:137339365-137339387 ACAAAAATCACAGACCAGGCCGG + Intronic
1185956928 X:4501276-4501298 ATAAAAATAAAAAATTAGGCAGG - Intergenic
1186222336 X:7363366-7363388 TTAAAAAAGATACAGTAGGCTGG + Intergenic
1186236578 X:7517406-7517428 ATAAACATGATAAAGTAGCCAGG + Intergenic
1186294694 X:8136068-8136090 ATAAACATAATACAGTAGCCAGG - Intergenic
1186933687 X:14423338-14423360 TTAAAAATCAGAGAATTGGCTGG + Intergenic
1187155405 X:16716529-16716551 TTAAAAATAAGAGATTAGGCTGG - Intergenic
1187345279 X:18458217-18458239 ATAAAAAACATTAAGCAGGCTGG - Intronic
1187530809 X:20094956-20094978 ATAAAAATCAGTGACTAGGCCGG + Intronic
1187859722 X:23669218-23669240 TTAAAAATCTCAAAGTAGGCTGG - Intronic
1187910829 X:24109756-24109778 ATAAAAATTACAAAATAGGCTGG - Intergenic
1188014251 X:25090462-25090484 TTAAAAATAATAAAATAGGCTGG - Intergenic
1188469792 X:30525485-30525507 ATAAAGATCATAGAGTTGGCTGG + Intergenic
1188861936 X:35268807-35268829 ATAAGAATGATACAGTGGGCCGG + Intergenic
1189425369 X:40895745-40895767 ATAAAAATTTTAAAGTAGGCCGG + Intergenic
1190026275 X:46926204-46926226 AAAAAAATTATACAGTAGGTTGG + Intronic
1190095293 X:47474882-47474904 AAAAAAAAAAAAGAGTAGGCCGG + Intronic
1190251881 X:48733104-48733126 AAAAAAATAATAAAATAGGCCGG - Intergenic
1190286561 X:48965345-48965367 CTAGAAAGCATAGAGCAGGCCGG - Intronic
1192420050 X:71021590-71021612 AAAAAAACCATAAATTAGGCCGG + Intergenic
1192461590 X:71321661-71321683 ATAAAAATTAAAAATTAGGCCGG - Intergenic
1192791676 X:74388251-74388273 ATAACAATTAAAAAGTAGGCTGG + Intergenic
1192805785 X:74507250-74507272 AAAAAAATCACAGATGAGGCTGG - Intronic
1193814945 X:86093319-86093341 ATAAAAATAAAAAAGGAGGCTGG + Intergenic
1194024796 X:88738455-88738477 ATAAAAATAATAAAATAGCCAGG - Intergenic
1195007736 X:100702770-100702792 ATGAAAATCACAGAGTAGCAGGG + Intronic
1195321203 X:103723449-103723471 ATAAAAATGCCAGAGTGGGCAGG - Intronic
1195525056 X:105878270-105878292 ATAAAAATTATTGAGTATGTTGG - Intronic
1195779102 X:108440587-108440609 ACAAAATTCAAAGAGTGGGCTGG - Intronic
1197219599 X:123898648-123898670 ATAAAAATAAAAGATAAGGCTGG - Intronic
1197228213 X:123974871-123974893 ATGAAAATCAAATACTAGGCCGG - Intronic
1197231509 X:124008769-124008791 ATAATAATCATAGAATAAGATGG + Intronic
1197249669 X:124201926-124201948 ATAAAAATCTTACAGTAACCAGG + Intronic
1198059944 X:133035604-133035626 ATAATAATAATAAAGGAGGCAGG - Intronic
1198222847 X:134618564-134618586 ATAAAAATAAAAGATTAGCCAGG - Intronic
1198342070 X:135724413-135724435 AAAAAAAGCATAGAATGGGCTGG - Intergenic
1198343367 X:135736121-135736143 TTTAAAATCATAGAATGGGCCGG - Intergenic
1198345920 X:135758883-135758905 AAAAAAAGCATAGAATGGGCTGG + Intergenic
1198347834 X:135776382-135776404 AAAAAAAGCATAGAATGGGCTGG + Intergenic
1198349739 X:135793644-135793666 AAAAAAAGCATAGAATGGGCTGG + Intergenic
1198351642 X:135810920-135810942 AAAAAAAGCATAGAATGGGCTGG + Intergenic
1198353553 X:135828182-135828204 AAAAAAAGCATAGAATGGGCTGG + Intergenic
1198355458 X:135845438-135845460 AAAAAAAGCATAGAATGGGCTGG + Intergenic
1198357368 X:135862723-135862745 AAAAAAAGCATAGAATGGGCTGG + Intergenic
1198359282 X:135880002-135880024 AAAAAAAGCATAGAATGGGCTGG + Intergenic
1199213755 X:145244143-145244165 ATAAAAAGAGTAGAGTCGGCCGG - Intergenic
1200156210 X:153977316-153977338 TTAAAAATAATAAAATAGGCTGG + Intronic
1200295983 X:154920748-154920770 ATCAAAAACATAAAATAGGCTGG - Intronic
1201949236 Y:19545796-19545818 ATAAAAATCAGAGAAGAGACTGG - Intergenic