ID: 990963407

View in Genome Browser
Species Human (GRCh38)
Location 5:61418557-61418579
Sequence TTAAATAAAAATCATAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 968
Summary {0: 1, 1: 0, 2: 6, 3: 76, 4: 885}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990963407_990963410 13 Left 990963407 5:61418557-61418579 CCTACTCTATGATTTTTATTTAA 0: 1
1: 0
2: 6
3: 76
4: 885
Right 990963410 5:61418593-61418615 GTGACTATCTAGATGAGTGAGGG No data
990963407_990963409 12 Left 990963407 5:61418557-61418579 CCTACTCTATGATTTTTATTTAA 0: 1
1: 0
2: 6
3: 76
4: 885
Right 990963409 5:61418592-61418614 AGTGACTATCTAGATGAGTGAGG No data
990963407_990963411 14 Left 990963407 5:61418557-61418579 CCTACTCTATGATTTTTATTTAA 0: 1
1: 0
2: 6
3: 76
4: 885
Right 990963411 5:61418594-61418616 TGACTATCTAGATGAGTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990963407 Original CRISPR TTAAATAAAAATCATAGAGT AGG (reversed) Intronic
900614484 1:3558856-3558878 TTAAAAAAAAATTGTAGAGATGG - Intronic
901578959 1:10224723-10224745 TTAAATAAAAAACATAAATTGGG - Intronic
901756979 1:11447344-11447366 ATAAATAAAAATTAAAAAGTTGG - Intergenic
902005202 1:13226330-13226352 TTAATGAAAATTCATGGAGTAGG - Intergenic
902683799 1:18062532-18062554 TAAAAAAAAAAGGATAGAGTTGG - Intergenic
903435817 1:23348368-23348390 CTATATAAAAATCATGGAGTTGG + Intergenic
903548055 1:24139180-24139202 TTACATAAAAAGTCTAGAGTAGG - Intronic
903847657 1:26288075-26288097 TTAAAAAAAAATTGTAGAGATGG + Intronic
904020231 1:27458355-27458377 TCAAATAAAAAACATAAAATTGG + Intronic
904251340 1:29226557-29226579 TTAAATAAAAAATATAGATGGGG - Intronic
904918990 1:33991779-33991801 TAAAATACAAATTACAGAGTAGG + Intronic
905579252 1:39071124-39071146 ATAAATACAAATCAGGGAGTTGG - Intergenic
905585080 1:39110562-39110584 TTAGATCAAAGTCCTAGAGTTGG + Intronic
905722048 1:40212440-40212462 TTTAATAAAAGTTATAGACTTGG + Intronic
906464269 1:46062246-46062268 TTACATACAAGTAATAGAGTAGG - Intronic
906737553 1:48145934-48145956 TTAAACAAAATTAATAAAGTAGG + Intergenic
906771382 1:48487984-48488006 TTAAATAAAGTTATTAGAGTAGG + Intergenic
906821104 1:48931084-48931106 TTGAGTAAAAATCATTGAGATGG - Intronic
907111415 1:51929614-51929636 TTTAATAAAAAAAATAGAATTGG - Intronic
907732302 1:57078810-57078832 TTAAAGAAGAATCATAGAGCCGG - Intronic
907791751 1:57673021-57673043 TTAACAAAATACCATAGAGTGGG + Intronic
908276597 1:62479659-62479681 ATAAATAAAAAACAAAAAGTAGG - Intronic
908642169 1:66237311-66237333 TCAAATAATAATCATAAAATTGG - Intronic
908771623 1:67602065-67602087 TTAAAAAAAAATACTTGAGTGGG + Intergenic
909280042 1:73738966-73738988 ATAAATAAAAATTATATAGATGG + Intergenic
909755251 1:79218187-79218209 TAAAATAGTAATCATAGAGTAGG - Intergenic
909875667 1:80799477-80799499 TTTATTAAAAATCTTTGAGTAGG + Intergenic
910406510 1:86897003-86897025 TAAAAAAAAAATCAAAGAGCAGG + Intronic
910430248 1:87152934-87152956 TGCAAAAAAAATCATATAGTTGG - Intronic
910455783 1:87395864-87395886 TTTTTTAAAAATAATAGAGTTGG - Intergenic
910863951 1:91770228-91770250 TTAAAAAAAAAAAAAAGAGTGGG + Intronic
911500216 1:98676907-98676929 TAAAAAAAAAATCATAAAGGAGG - Intronic
911500226 1:98677085-98677107 TAAAAGAAAAAGTATAGAGTTGG + Intronic
911544135 1:99196279-99196301 TTACATAAAAGTCAAAAAGTTGG + Intergenic
911831494 1:102555332-102555354 TTAAACAAACATAATAAAGTGGG - Intergenic
911996144 1:104769299-104769321 TTAAAAAAAAATTGTAGAGGTGG - Intergenic
911999700 1:104817053-104817075 TTAAAGAAATATCATAAAATTGG + Intergenic
912030103 1:105229655-105229677 TTATATAACACTCAAAGAGTTGG - Intergenic
912161725 1:106993852-106993874 TAAAATAAAAATCATTTAGGAGG + Intergenic
912350890 1:109011881-109011903 TAAAATAAAAATAATAAACTTGG + Intronic
912571334 1:110625652-110625674 TCAAAGAAAAATGATAAAGTGGG + Intronic
912995349 1:114527600-114527622 AAAAAAAAAAATCATAGACTGGG - Intergenic
913031809 1:114914395-114914417 TAAAAAAAAAAATATAGAGTGGG - Intronic
913106669 1:115620877-115620899 TTAAAAAAAAAACATTGAATGGG + Intergenic
913435393 1:118842337-118842359 TTAAATAATGCTCATAAAGTAGG - Intergenic
914457941 1:147854471-147854493 TGAAAAAAAAATCATAGGCTTGG + Intergenic
914891308 1:151625961-151625983 TAAAATAAAAATAAAAGATTGGG + Intronic
915451170 1:156006369-156006391 ATAAATAAAAATAATAAAATAGG + Intronic
916190795 1:162176157-162176179 TTTAAAAAAAATCATTGAGTGGG - Intronic
916208033 1:162334258-162334280 TTAAATGCAAATCATGGAGTTGG + Intronic
916307680 1:163357622-163357644 TCACATGAAAATCATAGAATAGG + Intergenic
916319613 1:163489269-163489291 TTAAACAATAATCAAAGAGATGG - Intergenic
916498081 1:165363079-165363101 TTAAATTAAAATTATATACTGGG + Intergenic
916647339 1:166798646-166798668 TTAAATAATAATCATGGTGAGGG - Intergenic
917051825 1:170932932-170932954 TTAAATAAATATCTGAGACTGGG + Intergenic
917144808 1:171878123-171878145 TTTAAGAAAAATGAAAGAGTAGG + Intronic
917766465 1:178223941-178223963 TAAAAGAAAGATCATAGTGTAGG + Intronic
918173628 1:182023084-182023106 TCCAATAAAAATCCTAGAATTGG + Intergenic
918311878 1:183290915-183290937 CTAAAAAAAAATCATTAAGTTGG - Intronic
918739062 1:188103799-188103821 TGAAACAAAACTCATAGATTTGG - Intergenic
918884352 1:190171934-190171956 AAAAAAAAAAATTATAGAGTTGG - Intronic
918976948 1:191501738-191501760 TTATATAAAAATCCTAAAGTAGG + Intergenic
918985231 1:191616537-191616559 GTAAAAAAAAATCAGAAAGTAGG + Intergenic
919132276 1:193466475-193466497 TTAAATTAAATTAATAGAGTAGG - Intergenic
919239543 1:194894635-194894657 TTAAGTAAATATCAAAAAGTGGG - Intergenic
919366267 1:196665131-196665153 CTAAAGAAAAATGTTAGAGTAGG - Intronic
919374258 1:196772963-196772985 TCAATTAAAAGACATAGAGTCGG - Intergenic
919786033 1:201259387-201259409 TAAAAAAAAAATCAGTGAGTTGG + Intergenic
920169576 1:204063063-204063085 TTAAATTAAAATCATGGTGGTGG - Intergenic
921245869 1:213239349-213239371 TTAAATAAATAAAATAGAGAAGG + Intronic
921355862 1:214283537-214283559 TTTAATAGAAATCATGAAGTAGG - Intronic
921655142 1:217725785-217725807 TTAAATTAAACTTATAGTGTAGG + Intronic
922145659 1:222941497-222941519 TTAAATAAACATCATGCAATAGG - Intronic
922518427 1:226224953-226224975 TTAGATCAGAATCTTAGAGTTGG + Intronic
923423915 1:233848783-233848805 TTAAATAAAATTCAGAGTCTCGG + Intergenic
923507074 1:234613182-234613204 TTAAATAAAAATCACAGTGTAGG + Intergenic
923580282 1:235203879-235203901 TTATATAAAATTCATAAAGTAGG - Intronic
924005281 1:239602504-239602526 TTAAATAACAAACAGATAGTAGG + Intronic
924203955 1:241691716-241691738 TTAAATTAAAAACATAGGCTGGG + Intronic
924336264 1:242989437-242989459 CTACATAAAAATAATAAAGTGGG - Intergenic
924667084 1:246083997-246084019 TTAAAAAAAAATCCTTGGGTGGG - Intronic
1063277054 10:4580930-4580952 TAAAATAAAAATATAAGAGTAGG + Intergenic
1063345508 10:5308397-5308419 TTAATTAAAAATCTTAGAATTGG - Intergenic
1063497398 10:6523033-6523055 TAAAAAAAAAATCACATAGTTGG + Intronic
1063717228 10:8540041-8540063 TTAAAGAAAAAGCAAAGATTTGG + Intergenic
1063812819 10:9733325-9733347 TGTAATAAAAATCAGAGAGTGGG + Intergenic
1064428098 10:15247771-15247793 GTAAATAAAAATGATATAGTAGG - Intronic
1064656009 10:17556882-17556904 TTAAATATAAATCTTAGAAGTGG - Intergenic
1065165588 10:22973706-22973728 GAAAATAAAAATAATATAGTGGG - Intronic
1065296105 10:24276927-24276949 AAAAATAAAAATCGTAGAGATGG + Intronic
1065480220 10:26185638-26185660 TTAAATAATAATCCTGGAATGGG - Intronic
1065696346 10:28383948-28383970 TTAAATAACAAACTTAGAGGTGG + Intergenic
1066011369 10:31196794-31196816 TTAAAGAAAAGTCACAGAATGGG - Intergenic
1067744064 10:48921170-48921192 TTGAAAAAGAATAATAGAGTTGG + Intronic
1067818190 10:49499918-49499940 TTACATAAAGTTCATAGATTGGG + Intronic
1067846414 10:49725494-49725516 TTAAATAAAATCTATAGATTAGG + Intergenic
1067937979 10:50626964-50626986 TTTAATAAACATCATATTGTTGG + Intergenic
1068027736 10:51669156-51669178 TTAACAAAATATCATAGACTGGG + Intronic
1068060199 10:52058783-52058805 ATAAAGAAAAATGATAAAGTGGG + Intronic
1068125498 10:52837217-52837239 TTAAATTGAGATCATAGAGCAGG + Intergenic
1068212858 10:53944004-53944026 TTGAATACAAATGATGGAGTTGG + Intronic
1068397016 10:56475883-56475905 TGAAATAAAAATTATAGTTTTGG + Intergenic
1068414698 10:56704634-56704656 TCAAATAAAAAATATACAGTTGG - Intergenic
1068434072 10:56968445-56968467 TTAAATTAAAATCTTAAAGCTGG - Intergenic
1069318035 10:67132316-67132338 TTAAGTAGAAATCTAAGAGTCGG + Intronic
1070199986 10:74195005-74195027 TAAAATAATAATTATAGTGTAGG + Intronic
1070261704 10:74862476-74862498 TTAAATAAAAATGTTGGAGTGGG + Intronic
1070374614 10:75817444-75817466 TTATTTTAAAATCACAGAGTTGG - Intronic
1070393827 10:75994225-75994247 ATATATAAAGACCATAGAGTGGG - Intronic
1070459503 10:76650183-76650205 TAAAATAAAAATCAAAGCCTAGG - Intergenic
1071748612 10:88450095-88450117 TTATATAAGAATCTTACAGTAGG + Intronic
1071802486 10:89079070-89079092 TGAAATAAAAATGGTGGAGTAGG + Intergenic
1071944415 10:90626011-90626033 TCAAAGAAAAATTTTAGAGTTGG + Intergenic
1072356440 10:94616597-94616619 TAAAATAAAAACAATAGGGTCGG + Intergenic
1072500077 10:96006565-96006587 TTAATTAGCAGTCATAGAGTTGG - Intronic
1072502012 10:96026825-96026847 TTGAATAAAAATCACAGGCTGGG + Intronic
1072646748 10:97261979-97262001 TTACATAAAAATCAGAGAAAAGG + Intronic
1072696031 10:97603526-97603548 TTAAATATAAAATATACAGTAGG - Intronic
1073026781 10:100493553-100493575 TTAAATAACAATGATAGAGCTGG + Intronic
1073655720 10:105413510-105413532 TGAAATAAAAAGCATAAAGCAGG - Intergenic
1073773827 10:106764463-106764485 TTTAATAAAATTCATAGTGTTGG + Intronic
1074328765 10:112481181-112481203 TTAAATAAAAAATTTAAAGTTGG + Intronic
1074776002 10:116768799-116768821 TTAAAAAAAAATAATTGAGCCGG - Intergenic
1076997019 11:302730-302752 TTAAATAAAACTCATCTGGTTGG + Intergenic
1077783325 11:5355761-5355783 TTAAAAAAAAAAAAAAGAGTAGG + Intronic
1077815834 11:5684645-5684667 TCAATTAAAAAGTATAGAGTAGG + Intronic
1078829735 11:14968140-14968162 TTAACTAAAAATCAAAGCGGAGG + Intronic
1078929715 11:15903774-15903796 TTAAAAAAAAATAATAATGTAGG + Intergenic
1079410922 11:20186715-20186737 ATAAATAAAAATAATAAATTTGG + Intergenic
1079432099 11:20401665-20401687 AAAAATAAATATCATAGAATGGG - Intronic
1079504792 11:21141724-21141746 ATAAATAAAAAGGATAGAGGAGG - Intronic
1079606718 11:22378181-22378203 TTAAGTGAAAATCATGGAGTTGG + Exonic
1080051476 11:27863493-27863515 TTAAATTAGAATCTTAGAGGTGG + Intergenic
1080161560 11:29182622-29182644 ATAAATAAAAAGAATATAGTGGG + Intergenic
1080191134 11:29550553-29550575 TTAAAAAAAAATCTTAGACTGGG + Intergenic
1080222946 11:29927521-29927543 TATAACAAATATCATAGAGTGGG - Intergenic
1080320097 11:30998296-30998318 TAAAATAAAAATTAAAAAGTGGG + Intronic
1080912077 11:36611671-36611693 TTAAACAAAAAACATAGATGTGG + Intronic
1080980225 11:37394089-37394111 ATAAACAAAAATCATAGAGCTGG - Intergenic
1081067612 11:38565339-38565361 TAAAATAAAAATAATAGAAATGG - Intergenic
1081137405 11:39456002-39456024 TTAAGTAAAAATCTAAGAGCAGG - Intergenic
1081293729 11:41359715-41359737 TAAAAAATAAATCATAGAGAAGG + Intronic
1082696000 11:56365431-56365453 TTAAAAATAAATCATTTAGTAGG + Intergenic
1082840746 11:57687715-57687737 GTAGAGAAAATTCATAGAGTAGG + Intronic
1083058357 11:59844834-59844856 ATAAATAAAAATAATAGAGATGG - Intronic
1084291587 11:68173339-68173361 TTCAATAAAAATAGTAGAGTTGG - Intronic
1084371542 11:68748171-68748193 TCAAATAAAAATCACAGAGCAGG + Intronic
1084394818 11:68902459-68902481 ATTAATAATAATCACAGAGTTGG - Intronic
1085672964 11:78486168-78486190 TTAAAAAAAAATAATAGGCTGGG - Intronic
1085673026 11:78486918-78486940 ATAAATAAAAATTTTAGAATTGG + Intronic
1085831553 11:79906394-79906416 TTTATTAAAAATTATAGAGAAGG - Intergenic
1086340940 11:85847475-85847497 TTGAATAAATATCTAAGAGTGGG + Intergenic
1086346579 11:85903269-85903291 TAAAATAAAAATAAAATAGTTGG - Intronic
1086557965 11:88134229-88134251 TAAAATAAAATAAATAGAGTTGG - Intronic
1086641821 11:89168210-89168232 TTATATAAAAAGCATAGAGTAGG + Intergenic
1086664721 11:89466167-89466189 ATAACTAAATATCATAGACTAGG - Intronic
1086959946 11:92971259-92971281 TTAGCTAAAAATCCTAGAGTTGG - Intronic
1087247106 11:95852300-95852322 TTATATAAAAAGGATAGATTTGG - Intronic
1087525126 11:99299366-99299388 CCAAATAAAAATTATAAAGTTGG + Intronic
1087647437 11:100824741-100824763 TTATACACAAATCATGGAGTAGG - Intronic
1087767843 11:102175582-102175604 TTGTATAAATATCATAGAGTAGG + Intronic
1088030118 11:105238337-105238359 CTAAAAAAAAATCAGAGAATGGG + Intergenic
1088169168 11:106976209-106976231 ATAAATATAAACCATGGAGTTGG + Intronic
1088173901 11:107028925-107028947 TTAGATAATAATCATAGTGGAGG - Intergenic
1088429457 11:109742857-109742879 TTAAAAAAAAAAAAAAGAGTGGG + Intergenic
1088551387 11:111016442-111016464 TTAAGTGAAATTCATAGATTTGG - Intergenic
1088925697 11:114299098-114299120 ATAAATAAAAAGCATAAAGTTGG - Intronic
1088961763 11:114674292-114674314 TTAAATAAAAATAACACAATGGG + Intergenic
1090122857 11:124051149-124051171 ATAAAAAAACATCATAGAATTGG - Intergenic
1090524438 11:127516083-127516105 TTAAATAAATACCCAAGAGTGGG + Intergenic
1090545740 11:127765702-127765724 TTGAAAAAAAATAAAAGAGTTGG - Intergenic
1090587593 11:128231375-128231397 TTAAAGAAATAGCATAGAGATGG + Intergenic
1090638079 11:128705596-128705618 TTAAAAGGAAATCATTGAGTAGG + Intronic
1090862038 11:130662563-130662585 GGAAATAAAAATCATTAAGTTGG + Intergenic
1092168612 12:6359272-6359294 TTAAAAAAAGATTATAGGGTGGG + Intronic
1092280620 12:7095428-7095450 TTTACTAAAAATTAAAGAGTTGG + Exonic
1092521425 12:9277379-9277401 TGAAATAAAAACCAGTGAGTTGG - Intergenic
1092571196 12:9723713-9723735 TAAAATCAAAAACATAGAGGGGG + Intronic
1093087306 12:14880618-14880640 TTAAAATAACATCAGAGAGTTGG + Intronic
1093147763 12:15587267-15587289 TTAAATGAAAAAAATAGAGAAGG + Intronic
1093355242 12:18159051-18159073 TTAATTAAAAACCATAAACTGGG + Intronic
1093438220 12:19162572-19162594 TTAAAAAAAAAAAAAAGAGTTGG + Intronic
1093666049 12:21814464-21814486 GTAAATAAAAGACATAGAATTGG - Intronic
1093811489 12:23497789-23497811 TTAAAGAAGAATCAAAGAGGAGG - Intergenic
1093846050 12:23972657-23972679 TTAAATAAAAAACATAAAAAGGG - Intergenic
1093986822 12:25542809-25542831 TTAAATAAAAAACAAAAAATAGG + Intronic
1093989084 12:25569905-25569927 ATAAATAAATATCAGAGACTGGG - Intronic
1094354241 12:29560765-29560787 TTAAGTAGAATTAATAGAGTAGG + Intronic
1094633228 12:32198540-32198562 TTAAATAAAAAAAAAAGAGTGGG - Intronic
1094641555 12:32280792-32280814 TAAAATAAAAAGCATAGGGCTGG - Intronic
1095609097 12:44106281-44106303 TTAAATATAAATAATAGACAAGG - Intronic
1095774672 12:45999449-45999471 ATAAAAAAAAATCACAGACTGGG - Intergenic
1096640836 12:52993111-52993133 TTAAAGAAAGTACATAGAGTAGG + Intergenic
1096698722 12:53368044-53368066 TTAAATAAAACTAATACAGTTGG + Intergenic
1096700882 12:53381814-53381836 GTAAGTGATAATCATAGAGTGGG + Intronic
1096724804 12:53552975-53552997 TTTAATAATAATAATAGAGAAGG + Intronic
1096858822 12:54507805-54507827 TTAATAAAAAATCAAAGAGAAGG - Intronic
1097096777 12:56555582-56555604 TAAAATAAAATGCATAGAGGCGG - Intronic
1097436550 12:59557095-59557117 CTAAAGAAAACTCATAAAGTGGG - Intergenic
1097579656 12:61439166-61439188 TGAAACAAAACTCATACAGTAGG - Intergenic
1098039708 12:66341596-66341618 TAAAATAAAATTCACAGAATGGG - Exonic
1098206185 12:68112677-68112699 ATAACAAAACATCATAGAGTGGG + Intergenic
1098289380 12:68942527-68942549 ATAATTAAAAATCAGAGAGTGGG - Intronic
1098366372 12:69707394-69707416 TTAAATCAGAAACTTAGAGTGGG + Intergenic
1098397015 12:70029890-70029912 TTAAGTAAAAAACATTGAGGAGG + Intergenic
1098746871 12:74248831-74248853 TTAAAGAGTAATCATAGAGGGGG - Intergenic
1098940637 12:76530959-76530981 TTTAATAAAAATAATAGGGATGG - Intronic
1099059777 12:77892714-77892736 TGAAATAAAATTCAGATAGTTGG - Intronic
1099125428 12:78750301-78750323 ATAAATAAATAGCATAGAGATGG + Intergenic
1099165525 12:79302361-79302383 TTTAATTAACATCACAGAGTTGG - Intronic
1099289673 12:80761409-80761431 TTAAATAAAGTAGATAGAGTAGG + Intergenic
1100069088 12:90688903-90688925 CTAAATAAAAATAACAGAGGTGG + Intergenic
1100171025 12:91975359-91975381 TTACATAATAATAATAAAGTAGG + Intergenic
1100245048 12:92749257-92749279 TTAATTAAAAAACAAACAGTAGG - Intronic
1100245229 12:92750956-92750978 ATAAATAAAAATAAAACAGTTGG + Intronic
1100440596 12:94613792-94613814 TAAAATAAAAACTATGGAGTAGG + Intronic
1101255079 12:102968802-102968824 TGAAATAAAAACTCTAGAGTTGG + Intergenic
1101271894 12:103156240-103156262 ATAAATAAGAATCATACATTAGG - Intronic
1101486120 12:105162791-105162813 TTAAATAAAAAAAATAAAATTGG + Exonic
1102509078 12:113402191-113402213 TCGAATAAAAATCAGAGACTGGG + Intronic
1102529535 12:113536196-113536218 TTTAAAAAAAAAAATAGAGTTGG - Intergenic
1103186574 12:118963027-118963049 TTAAAAAAAAATTATAGAAAGGG + Intergenic
1103356138 12:120322044-120322066 ATACATAAAAATAAAAGAGTAGG + Intergenic
1103599388 12:122044520-122044542 ATAAATAAAAATCAAACAATTGG + Intronic
1104185845 12:126430256-126430278 TTTAAAAAAAATCACTGAGTTGG - Intergenic
1105595456 13:21833695-21833717 TTACATCAAAATAAGAGAGTGGG + Intergenic
1105613799 13:21993811-21993833 TTAAATAATAATAATAGAAATGG - Intergenic
1106278259 13:28236354-28236376 TTAAATCAAAAACACAGATTTGG + Intronic
1106882845 13:34150457-34150479 TTAGAAAAAAATCTTAGAGAGGG - Intergenic
1106969622 13:35122717-35122739 ATAAAACAAAATCTTAGAGTAGG + Intronic
1107522436 13:41196515-41196537 TTAAAAAAAAATTATAGACAGGG + Intergenic
1107539787 13:41377906-41377928 TAAAATAAACATCATAGACCTGG + Intergenic
1107988520 13:45796915-45796937 TTTAATAAAAATCTTAGGCTTGG + Intronic
1108333490 13:49414600-49414622 TTAAATAAAAATCAAGAAATAGG + Intronic
1108420696 13:50246244-50246266 ATAAATAAAAATAAAAGTGTCGG - Intronic
1108977033 13:56459109-56459131 TTGAATAAAATCCATAAAGTAGG - Intergenic
1109409433 13:61943754-61943776 TTAAAAAAAAATCACAGAGTGGG + Intergenic
1109594900 13:64538463-64538485 TAAAACAAAAATTATAGAGATGG - Intergenic
1109948965 13:69476649-69476671 TATTATAAAAATTATAGAGTAGG + Intergenic
1109963705 13:69665243-69665265 TTTAATAGAAATTATTGAGTCGG + Intergenic
1109972838 13:69792120-69792142 CTAAAAAAAATTCATAGAATGGG + Intronic
1110511927 13:76361168-76361190 TGAAATAAAAAGCAAAGAGATGG - Intergenic
1110599287 13:77353466-77353488 GTAAATAAAAAGCATTAAGTTGG + Intergenic
1110800666 13:79690478-79690500 TTAAATAGAAATGACATAGTGGG + Intergenic
1111248040 13:85567980-85568002 TTAACAAAATATCAGAGAGTGGG + Intergenic
1111380882 13:87450025-87450047 TTAAATAAAAGTGGCAGAGTAGG - Intergenic
1111706099 13:91751021-91751043 TTAAACAAAAATAATTGAGATGG - Intronic
1111834417 13:93370175-93370197 TTTAATTAAAATCCTAGAATTGG + Intronic
1111990797 13:95114902-95114924 TTAAATAGAAATACTACAGTTGG - Intronic
1113353711 13:109555991-109556013 TTTATTAAGAATCATAGAGTGGG + Intergenic
1114307286 14:21435476-21435498 TCAAATAAGAATGAGAGAGTTGG - Intronic
1114338716 14:21720334-21720356 TTCAATAGAAATCGGAGAGTTGG + Intergenic
1114476813 14:23001451-23001473 ATAAATAAAAATAAAAGAGAGGG - Intronic
1114744551 14:25133820-25133842 ATAAATAAAAATCTTAGATTTGG + Intergenic
1114881827 14:26795926-26795948 ATAAATAAAATTGTTAGAGTAGG + Intergenic
1115436847 14:33384754-33384776 TTAAATAAAAATAGTAAAATGGG - Intronic
1115443281 14:33460821-33460843 TTACAGAAAAACCAGAGAGTGGG + Intronic
1115474914 14:33803870-33803892 TTATATATATATCGTAGAGTTGG - Intronic
1116059276 14:39900151-39900173 TTAAAAAAAAATCAGAAAATGGG - Intergenic
1116159055 14:41243716-41243738 TTAGATAAAATTCAAAGAGAAGG - Intergenic
1116185472 14:41595654-41595676 ATAAATAAAAATAAAAGACTGGG + Intergenic
1116200544 14:41788983-41789005 TTAAAGAAAAATTAGAAAGTTGG - Intronic
1116321066 14:43463654-43463676 TTAAGTAAAAATAATAAAGCTGG - Intergenic
1116656145 14:47656194-47656216 TTAAATAAAAATGATACATTTGG + Intronic
1116695640 14:48173674-48173696 TTCCATAGAAATAATAGAGTAGG + Intergenic
1116913754 14:50500325-50500347 TTAAATAAATATCATATCCTCGG - Intronic
1117271741 14:54151447-54151469 ATAAATAAAAACCATAAAGTGGG + Intergenic
1117519341 14:56534683-56534705 TTAAATATAAATCATTGGTTTGG + Intronic
1117581346 14:57154449-57154471 TTAAATAAAGACATTAGAGTTGG + Intergenic
1117885111 14:60352989-60353011 TAAAATATACATCATATAGTAGG + Intergenic
1117906822 14:60598042-60598064 TTAGAAAAAAATAATAAAGTTGG + Intergenic
1117955844 14:61123166-61123188 TTAAAAAAAAATTATAAAATCGG + Intergenic
1118414327 14:65517861-65517883 TTAAATTAGAATCATAAAGCTGG - Intronic
1118702381 14:68446399-68446421 TTACAGGAAAATCATAGTGTAGG - Intronic
1119285008 14:73446310-73446332 TTAAAAAAAAATCCTAAACTGGG + Intronic
1119303031 14:73585737-73585759 TTAAATAAAAATCATTGCTGTGG + Intergenic
1119308623 14:73628312-73628334 TTAAAGAAAATTGATAGAGATGG + Intergenic
1119431524 14:74571034-74571056 TTAAAAAAAAAAAAAAGAGTGGG + Intronic
1120014132 14:79450885-79450907 TTAAATTAAAAATATAAAGTTGG + Intronic
1120115328 14:80609853-80609875 TCAAAAAAAAATCACACAGTTGG + Intronic
1120136437 14:80875642-80875664 TAAAATGAAAATCAGTGAGTGGG + Intronic
1121663613 14:95654652-95654674 TAAAAAAAAAATTATAGAGATGG + Intergenic
1121699060 14:95938207-95938229 TAAGATACAAATCATAGAGATGG + Intergenic
1122450805 14:101805480-101805502 TCAATTAAAAATAATAGAATGGG + Intronic
1123160298 14:106271864-106271886 TTTAACAAAAACCACAGAGTAGG + Intergenic
1123481795 15:20639245-20639267 GTAAGTAAAATTCACAGAGTGGG - Intergenic
1123636218 15:22361120-22361142 GTAAGTAAAATTCACAGAGTGGG + Intergenic
1124643932 15:31421495-31421517 TGAAATAAATAACATAAAGTAGG + Intronic
1124699827 15:31903230-31903252 ATAACAAAATATCATAGAGTAGG - Intergenic
1125099268 15:35891472-35891494 TAAAATAGAAATCAGAGAGAGGG + Intergenic
1125194494 15:37030808-37030830 TTAAAAAAAAATTATAGAGATGG + Intronic
1125202096 15:37109122-37109144 ATAAATAAAAAACATAAAATTGG - Intergenic
1125462033 15:39916803-39916825 ATAGAGAAAAATCATAGATTAGG - Intronic
1125568865 15:40699056-40699078 AGAAATAAAAATGATAAAGTAGG - Intronic
1125854367 15:42934861-42934883 TAAAATAAAAATAATAAAATGGG + Intergenic
1125863065 15:43015640-43015662 TTAAAAAAAAAAAATTGAGTTGG + Intronic
1126290347 15:47069236-47069258 TTAAATAAAAAACAAAAAGTAGG - Intergenic
1126343211 15:47666442-47666464 CTAAATAAAAATCAAGTAGTTGG - Intronic
1126595360 15:50379551-50379573 TAAAATAAAAATCATAAAATGGG + Intergenic
1126616889 15:50592081-50592103 TTTAATAAAAATCAAAAATTAGG - Exonic
1126811237 15:52407045-52407067 TTTACTAAAAATCATTGAATGGG - Intronic
1126840854 15:52716053-52716075 ATAAATAAAAATAAAAGAGAAGG + Intergenic
1126878069 15:53065568-53065590 GTCAATAAAAATCTTAGAATTGG - Intergenic
1127050161 15:55074437-55074459 TTATTTAAAAATCATAGGCTCGG + Intergenic
1127469452 15:59277244-59277266 CTAAATAAAAATCAAAGTCTGGG + Intronic
1128104773 15:65035461-65035483 TAAAAAATAAAACATAGAGTGGG - Intergenic
1128524338 15:68402339-68402361 TTAAAAAAAAATCATTGACTTGG + Intronic
1128654244 15:69448627-69448649 TTAAACAAAAAGCATAGTTTGGG + Intergenic
1129529390 15:76251015-76251037 TTAAATAAAAAGAAAAGAATGGG + Intronic
1129553786 15:76483046-76483068 TTAAATAAGAAGGATAAAGTTGG + Intronic
1129616436 15:77101978-77102000 TTAAATTAAGATCATATTGTTGG - Exonic
1129958700 15:79663564-79663586 TTAATTAAAAATGAAAGAGGTGG + Intergenic
1131320969 15:91390754-91390776 CAAAATCAAAATCATACAGTAGG + Intergenic
1131482286 15:92792454-92792476 TTAAAAAAAAAAAATAGAGACGG - Intronic
1131769746 15:95724185-95724207 GTAATTAAAAATTATAAAGTGGG - Intergenic
1131819969 15:96262497-96262519 TCAACTAAAAATAATAGAGCAGG - Intergenic
1133146643 16:3791907-3791929 CTAAAGAAAATTCAGAGAGTAGG - Intronic
1134326349 16:13211451-13211473 TTAAAAAAAAAGCATACACTTGG + Intronic
1134481021 16:14619297-14619319 TTAAATAAAAACATTAGACTGGG + Intronic
1134713541 16:16342270-16342292 TTAAAAAAAAATCATGTACTAGG - Intergenic
1134721411 16:16385628-16385650 TTAAAAAAAAATCATGTACTAGG - Intronic
1134946015 16:18326256-18326278 TTAAAAAAAAATCATGTACTAGG + Intronic
1134953278 16:18366400-18366422 TTAAAAAAAAATCATGTACTAGG + Intergenic
1135693590 16:24566306-24566328 TTAAGTAAAAATAACAGTGTTGG - Intronic
1137303516 16:47177751-47177773 TTAAATAAAAATTATCAACTAGG + Intronic
1137847320 16:51703514-51703536 TTAAATAAAGGTCATTTAGTAGG + Intergenic
1137890494 16:52156617-52156639 TAAAAAAAAAATCAAAAAGTGGG - Intergenic
1137933522 16:52611134-52611156 TGAAATAAAAATCAAACAATGGG + Intergenic
1137934028 16:52616827-52616849 TCAAAAAAAAATCATAAAATGGG + Intergenic
1138799221 16:60005901-60005923 TGCAATAAAAATCATAGAACAGG + Intergenic
1138913485 16:61432028-61432050 TTAAATAAAAATTCAAGAGGAGG - Intergenic
1138913949 16:61439940-61439962 TTTAATACAAATTATAAAGTTGG + Intergenic
1140225046 16:73070410-73070432 TTAAAAAAAAATAATAGAGGTGG - Intergenic
1140969064 16:79995439-79995461 TTCAATCAAAACCATAGAGTCGG - Intergenic
1141547358 16:84779894-84779916 ATCAATAAAAATCACAAAGTTGG + Intronic
1203143554 16_KI270728v1_random:1784531-1784553 TAAAATAAAAAAAAAAGAGTGGG + Intergenic
1143695579 17:8613649-8613671 TTAAAAAATAAACATAGAGCGGG + Intronic
1143716879 17:8779407-8779429 TTACTTAAAAATCAGAAAGTAGG + Intergenic
1144209990 17:13006068-13006090 TTAAAAAAAAATAATAATGTTGG + Intronic
1144700264 17:17333272-17333294 TAAAATACAAATCACAGACTGGG - Intronic
1145120458 17:20254898-20254920 TTAAATAAGGATTTTAGAGTTGG + Intronic
1145726751 17:27134767-27134789 TAAAATAAAAATCATGAAGGTGG + Intergenic
1146408504 17:32561343-32561365 TTAAAAAAAAAGGAGAGAGTTGG - Intronic
1146490732 17:33279715-33279737 TTTTAAAAAAATTATAGAGTTGG - Intronic
1147179943 17:38677944-38677966 TTTACTAAAAATCATTGAATTGG - Intergenic
1147301626 17:39533431-39533453 TTTAATAAAAAACAGGGAGTGGG - Exonic
1147942650 17:44060179-44060201 TAAAATAAAATAAATAGAGTAGG + Intronic
1148937217 17:51173096-51173118 ATACATAAAAAGCATAGAATTGG - Intergenic
1149728039 17:58916736-58916758 TTAAAGCAAAATCATAGAATTGG - Intronic
1149836803 17:59920413-59920435 TTAAATAAAAATCAGCAAGAAGG - Intronic
1150151289 17:62810559-62810581 TCAAATAAAAATAACAGAGGAGG + Intergenic
1150601359 17:66653642-66653664 ATAAATAAACATCAAGGAGTTGG + Intronic
1150713725 17:67553334-67553356 CTAATTAAAAACCAAAGAGTTGG - Intronic
1152062614 17:78089743-78089765 TGAAAGAAAAATCAGAGAGTAGG + Intronic
1152143711 17:78554505-78554527 TTAAATTAATTTCTTAGAGTAGG - Intronic
1153169372 18:2297817-2297839 TTAAATGAGAATAATAAAGTTGG + Intergenic
1153320382 18:3767928-3767950 GGAAATAAAAGGCATAGAGTTGG + Intronic
1153844313 18:9034553-9034575 ATAACAAAATATCATAGAGTGGG - Intergenic
1153897240 18:9576473-9576495 TTAAATAAAGCTTAAAGAGTCGG - Intronic
1154013494 18:10595681-10595703 TTAAGTAAAAATAATGAAGTAGG - Intergenic
1154152718 18:11919276-11919298 TTAAGTAAAAATAATGAAGTAGG - Intergenic
1154224693 18:12492679-12492701 TTACATAAAACTCATAATGTAGG + Intronic
1155028442 18:21963255-21963277 TGAAATAGAAAGCAGAGAGTGGG - Intergenic
1155269665 18:24127684-24127706 TTAAAAAAAAATTGTAGAGATGG + Intronic
1155301715 18:24435263-24435285 TTAAATAAAAATTAAGGACTGGG - Intronic
1155484770 18:26329798-26329820 AAAAATAAAAATCAAAAAGTGGG - Intronic
1155531114 18:26767593-26767615 TTAAATAAGAATTAAAGAGCAGG + Intergenic
1155693517 18:28655280-28655302 ATAAATAAATGTCATAGATTTGG + Intergenic
1155697043 18:28696755-28696777 TTAAATAAAACTCCCAAAGTTGG - Intergenic
1155873439 18:31055282-31055304 TCAAGTAAAAATCACAAAGTAGG + Intergenic
1156369817 18:36462795-36462817 TTAAATATATTTCATAGAGATGG + Intronic
1156564660 18:38173781-38173803 TTAAATAAAAATGATGGAAGTGG - Intergenic
1156763142 18:40618047-40618069 TTAATTAACAATCATATATTTGG + Intergenic
1157235383 18:45960268-45960290 TTAAAAAAAAATCAGAGACAAGG + Intronic
1157246684 18:46061001-46061023 TTAATAAAAAATCATACAGGAGG + Intronic
1157927596 18:51783225-51783247 ATAATAAAAAATCATAGACTAGG + Intergenic
1158638535 18:59182300-59182322 TTAAAAAAAAAAAAAAGAGTTGG - Intergenic
1158655509 18:59327421-59327443 TAAAAAAAAAATAAAAGAGTAGG - Intergenic
1159223455 18:65498180-65498202 TTAAATAAAAACTATCCAGTTGG + Intergenic
1159538849 18:69749638-69749660 GTAGATAAAAATCAATGAGTTGG + Intronic
1159620946 18:70637681-70637703 TTAAAAAAAAATTATAGAGATGG + Intronic
1159706887 18:71701370-71701392 TTATATAAAAAACATAAATTTGG - Intergenic
1160118726 18:76107922-76107944 TGAAATAAAAATCATAGGCCAGG - Intergenic
1160287505 18:77558493-77558515 TGAAAAAAAAATCATATAATAGG - Intergenic
1160761162 19:785326-785348 ATAAATAAAAATAAAAGAGCTGG - Intergenic
1160925102 19:1540567-1540589 TTCCATAAAAAGCACAGAGTTGG - Intergenic
1161174853 19:2835477-2835499 AAAAAAAAAAATTATAGAGTTGG + Exonic
1161673649 19:5629267-5629289 TTAAATAAAAGTCAATGAGCTGG + Intronic
1161853585 19:6751501-6751523 TTATATAAAGTTCCTAGAGTCGG + Exonic
1162223230 19:9197398-9197420 TTGTATAAAAACCAAAGAGTTGG - Intergenic
1162425416 19:10592432-10592454 TCAAATGAAGATAATAGAGTTGG - Intergenic
1162434577 19:10649771-10649793 ATAGATAAAAAACATAGAGATGG + Intergenic
1162568363 19:11456834-11456856 TTAAAAAAAAATTGTAGAGAAGG + Intronic
1162859777 19:13497751-13497773 TAAAATAAAATTCATTGAGTTGG + Intronic
1163203432 19:15784732-15784754 ATAAATAAAAATAAAAGAGAGGG - Intergenic
1164060107 19:21665428-21665450 TAGAATAAAAATGACAGAGTCGG - Intergenic
1164111509 19:22164043-22164065 TAGAATAAAAATGATGGAGTTGG + Intergenic
1164231785 19:23295290-23295312 ATAAATAAGAATCTTAGAGCTGG + Intergenic
1164247922 19:23449785-23449807 ATAAATAAGAATCTTAGAGCTGG + Intergenic
1164389195 19:27803409-27803431 TGAAATAAAAATGATAAGGTTGG + Intergenic
1164390515 19:27815731-27815753 ATAAATAAGAATCCTAGAGCTGG + Intergenic
1164505046 19:28853192-28853214 TTAAAGAAAGATCAGAGACTTGG + Intergenic
1165763821 19:38337695-38337717 ATAAATAAAAATGTTAGAGGTGG - Intronic
1165899759 19:39163645-39163667 TGAAATAAACATTTTAGAGTAGG + Intronic
1165926557 19:39329781-39329803 TTAAAAAATAATCATAGGGCCGG + Intronic
1166634828 19:44441777-44441799 TTAGAAAAAATTCTTAGAGTGGG + Intronic
1166860838 19:45810137-45810159 ATAAATAAAAATAATTGAGATGG - Intronic
1167048641 19:47066202-47066224 TTAAAAAAAAATAAAAGAGACGG + Exonic
1167131545 19:47589483-47589505 GGAAATAAAAATAATAAAGTGGG + Intergenic
1167189983 19:47979676-47979698 TTAAATAAAAATGTTAGTTTAGG + Intronic
1167330183 19:48850837-48850859 TAAAATAAAAATAAAAGAGTAGG + Intronic
1168261192 19:55195864-55195886 TTAAAATGCAATCATAGAGTGGG - Intronic
925629334 2:5873269-5873291 TTAATAAAATATCACAGAGTAGG - Intergenic
925739098 2:6989585-6989607 TTAAAAAAAAATCATTGAGGAGG - Intronic
925893251 2:8452831-8452853 TTAAATAAAGATTCTAGAGATGG - Intergenic
925965770 2:9064476-9064498 AGTAATAAAAATCTTAGAGTAGG - Intergenic
926351860 2:12002880-12002902 TTAACAAAATATCATAGACTGGG - Intergenic
926605368 2:14892545-14892567 TTAAATAGCAGCCATAGAGTCGG - Intergenic
927795689 2:26046585-26046607 TTAAAAAAAATTAATAGAGATGG + Intronic
928040721 2:27873989-27874011 TGATATAAAAATCATAAAGAAGG + Intronic
928447898 2:31349240-31349262 TTAAATATAAAGCACAGAGAAGG - Intronic
928635560 2:33242269-33242291 TTAATTGAAAATCAAAAAGTTGG - Intronic
929170720 2:38930514-38930536 TTAAAAAAAAATTATAGAAATGG + Intronic
929713110 2:44284542-44284564 TTAAATAAAAATTACAAAGTTGG - Intronic
930252227 2:49047634-49047656 TTTTGTAAAAATCATAAAGTGGG - Intronic
930855812 2:56017003-56017025 TTAAATAAAAATAGAAAAGTGGG - Intergenic
931089527 2:58870533-58870555 TCAAATATAAATCATTTAGTTGG - Intergenic
931486952 2:62703745-62703767 TTAAAAAAAAATAAAGGAGTAGG - Intronic
931622762 2:64227884-64227906 GTATCTAAAAATCATAGATTAGG + Intergenic
932065308 2:68551569-68551591 TTAAATAAACATCCTAGAACTGG - Intronic
932515433 2:72343123-72343145 TTAAATAAAAAACAAAAAGAAGG + Intronic
932937773 2:76126428-76126450 TTAAATAAAAATAAATGAATAGG - Intergenic
933030153 2:77318306-77318328 TTAAATAAAAATAAGAGTGTTGG - Intronic
933049107 2:77579614-77579636 TTAAAAAAAAATTGTAGAGATGG - Intronic
933669758 2:84995611-84995633 AGAAATAAAAATGATAAAGTTGG - Intronic
934087382 2:88521338-88521360 TTAAATAAAACTGAAAGAGATGG - Intergenic
934982861 2:98861057-98861079 GTAAATAAAAACCATAGTGATGG + Intronic
935092188 2:99905904-99905926 TTAAAAAAAAAACATTGAATGGG - Intronic
935420428 2:102863087-102863109 TAAAATAAATGTCACAGAGTTGG + Intergenic
935506300 2:103908343-103908365 TTCCCTAAATATCATAGAGTTGG + Intergenic
935553841 2:104485525-104485547 TTGAATAAAGATTATTGAGTGGG - Intergenic
935848346 2:107190723-107190745 TTTTATAAAAAGCATATAGTAGG - Intergenic
936105199 2:109617092-109617114 TTACATAAGAATCATTAAGTTGG - Exonic
936406468 2:112209085-112209107 TCAAATCAAAATCATAATGTAGG + Intergenic
936737395 2:115463023-115463045 TTAATTAAAAATTATAGGCTGGG - Intronic
938631150 2:133169116-133169138 TAAAATAAACATCATAAAGTGGG + Intronic
938656664 2:133441843-133441865 TTAAATAAAAGTCTTAGATATGG - Intronic
938755382 2:134374424-134374446 TTATATAAAAAACACAGATTGGG + Intronic
939342101 2:140910760-140910782 TTAGATAAAGATCAAAAAGTTGG + Intronic
939697637 2:145346380-145346402 TTAAAATAAAATAATATAGTAGG + Intergenic
939768256 2:146280973-146280995 TTTAAAAAAAATAATAGAGATGG + Intergenic
939833907 2:147104846-147104868 TAAAGTAAAAATCAAAGATTTGG - Intergenic
940977970 2:159967858-159967880 TTAAATTAAAATTACTGAGTTGG - Intronic
941256548 2:163239319-163239341 TTACATAAAAATCTTACAGCAGG + Intergenic
941514331 2:166454002-166454024 TTTAATAAAAATCAGAAAATGGG + Intronic
941521904 2:166555730-166555752 TAAAATAAAAATCAAAGAACAGG + Intergenic
941533291 2:166694526-166694548 TTAGAAAAATATCACAGAGTGGG + Intergenic
941573434 2:167200393-167200415 TTACCTAAAAAACATAGAGCAGG + Intronic
941647127 2:168052588-168052610 TTCATTAAAAATCATTCAGTTGG + Intronic
942068576 2:172294822-172294844 TTAAATAAAAAGCCTCCAGTTGG - Intergenic
942164488 2:173228770-173228792 TAGTATAAAAATCATAGGGTAGG - Intronic
942281723 2:174371062-174371084 TTATATAAAAAGTACAGAGTAGG + Intronic
942562904 2:177239060-177239082 TCAAATAAAAAACATTGAATTGG - Intronic
942741047 2:179178467-179178489 TTAAAAAAAAATAAAAGACTTGG + Intronic
942804373 2:179912397-179912419 TAAAATATATATAATAGAGTTGG - Intergenic
942888408 2:180957022-180957044 CTAAAAAAAAATCATAGACTGGG - Intergenic
942895999 2:181055248-181055270 TTAAAAAATAATAATAAAGTTGG + Intronic
942993675 2:182234920-182234942 TTATATTAAAATTATAGAGGGGG + Intronic
943020616 2:182568674-182568696 ATAAATAAATAACACAGAGTAGG + Intergenic
943049345 2:182896222-182896244 TTAAATAAAAAAGATACAGAAGG - Intergenic
943083343 2:183282849-183282871 TTGAATAAATAACTTAGAGTAGG + Intergenic
943126505 2:183799712-183799734 TTGAATACAAATCATAAAGATGG + Intergenic
943389576 2:187247379-187247401 TTTAATAAAATTCAGAGAATTGG - Intergenic
943453200 2:188071957-188071979 TTAAATAGCAGTCGTAGAGTGGG + Intergenic
943523239 2:188982045-188982067 TTAAGTAAAAAAAAGAGAGTTGG - Intronic
945121567 2:206462770-206462792 TTAAAAAAAAATAACAGAGCAGG - Intronic
945421451 2:209642140-209642162 TCAAATAAAAACCATAAAATGGG + Intronic
945554250 2:211259847-211259869 TTAAATATAAAACACAGGGTTGG - Intergenic
945558352 2:211306905-211306927 TTAATTAAAAATCAGAAACTGGG - Intergenic
945639000 2:212398798-212398820 TTGAATAAGAATCAATGAGTTGG - Intronic
945783165 2:214202496-214202518 TTTAATGAAAATTATAGAGAAGG + Intronic
946067516 2:217001441-217001463 TTAAATTAAAAAGATAGATTTGG + Intergenic
946634177 2:221706378-221706400 TTAAATGAGAATCAAAGAGGTGG + Intergenic
947411837 2:229849560-229849582 TTAAAAAAAAATAATAGATCTGG + Intronic
947481912 2:230508629-230508651 TTAAATATAAAAGATAGAGCTGG + Intronic
947800436 2:232926177-232926199 TTAAATAAAAATTCTAGGTTTGG - Intronic
947854990 2:233317594-233317616 TTAAAAATAAATTATAGAATTGG - Intronic
948096761 2:235341588-235341610 TTAAATAAAAATCATCAAAGCGG + Intergenic
948328577 2:237147021-237147043 GTACATAGAAATTATAGAGTTGG + Intergenic
948436940 2:237960281-237960303 TTAAAAAAAAATAATACAGTGGG - Intergenic
1169974667 20:11311282-11311304 TTAACTCAAAATCTTAGAGTGGG - Intergenic
1170023977 20:11868403-11868425 ATTAATAAAAATCATAGACCAGG - Intergenic
1170471317 20:16670755-16670777 TTAAATAAAATTTAGAGTGTTGG + Intergenic
1170941901 20:20855014-20855036 TTAAAAAAAATTAATAGAGATGG + Intergenic
1171276898 20:23864384-23864406 TTAAACAAAAATAATAGAATTGG - Intergenic
1172352407 20:34253424-34253446 TAAAATAAAAATAAGAGCGTAGG - Intronic
1173033057 20:39380153-39380175 TTAATTATAAATAATAGAATAGG + Intergenic
1173087147 20:39933927-39933949 TTAAATAAGAAAAATAAAGTTGG + Intergenic
1173674176 20:44819708-44819730 TTAAATATAAATCTTTGAATGGG + Intergenic
1174014458 20:47476593-47476615 TTAAAAAAAAATTATAGAGATGG + Intergenic
1174329597 20:49807655-49807677 TTAAAAAAAAATCATAGTTTTGG - Intergenic
1174341468 20:49899438-49899460 ATAAATAAAAATGATAAAATGGG + Intergenic
1174669732 20:52295614-52295636 TTAAATAGAAATGATACTGTTGG + Intergenic
1174683407 20:52430410-52430432 TAAAATGAAATTCTTAGAGTGGG - Intergenic
1175093913 20:56526894-56526916 TTAATTTAAAATAATAGAGATGG - Intergenic
1175170650 20:57078340-57078362 TTGAAGAAAAATAACAGAGTTGG - Intergenic
1175179999 20:57139252-57139274 ATAAATAAAAAGTAAAGAGTTGG - Intergenic
1175609057 20:60334932-60334954 TTCAACAAAAATCCTAGAGAAGG + Intergenic
1175647461 20:60687014-60687036 CAAAATAAAAATCGAAGAGTTGG + Intergenic
1177019144 21:15831089-15831111 TTGAATAAAAAGCTTATAGTGGG - Intronic
1177163796 21:17577841-17577863 TAAAATAGAAAGCAGAGAGTAGG - Intronic
1177886525 21:26752832-26752854 TTAGATATAAGTAATAGAGTGGG - Intergenic
1178257136 21:31064361-31064383 CTATATAAAAATCATAGCCTGGG - Intergenic
1178466291 21:32851448-32851470 TGAAATAATTATCATAGTGTTGG - Intergenic
1178788846 21:35679316-35679338 TAAAATAAACATCCTAGACTGGG + Intronic
1179039323 21:37787896-37787918 TTAATTAATAATAATAGGGTTGG + Intronic
1179068123 21:38045512-38045534 TCAAATAAAAATGACTGAGTAGG + Intronic
1179171289 21:38974965-38974987 GGAAATAAAAATCACACAGTGGG - Intergenic
1181146586 22:20852748-20852770 TGGAGTAAAAATCATAGTGTTGG - Intronic
1181809961 22:25397943-25397965 TTAAATAATAATAATAAAATAGG + Intronic
1181967077 22:26664397-26664419 TTTATTAAAAATCATTGAATGGG - Intergenic
1182652337 22:31862256-31862278 ATAAATAAAAATAAAAGATTTGG + Intronic
1182970841 22:34574891-34574913 TTAAATAAAAAACAAATATTGGG + Intergenic
1182982259 22:34683616-34683638 TAAAATAATAATAATAGTGTAGG - Intergenic
1183783189 22:40012034-40012056 TTAACAAAAAATCAGAAAGTTGG - Intronic
1183783191 22:40012075-40012097 TTAATGAAAAATCAGAAAGTTGG - Intronic
1183840884 22:40500227-40500249 AAAAAAAAAAATCATAGACTGGG - Intronic
1183967199 22:41448780-41448802 TTAAATCAAGATCACACAGTCGG - Intergenic
1184313159 22:43661816-43661838 ATAAATATAGTTCATAGAGTTGG + Intronic
949258406 3:2077938-2077960 ATAAAGAAATATCATAGACTGGG + Intergenic
949627935 3:5888626-5888648 TTAAAAAAAACTCACAGACTGGG - Intergenic
949645780 3:6092138-6092160 TTAGAGAAGAATCTTAGAGTAGG + Intergenic
950298691 3:11854922-11854944 TTTAAAAAAAATCATAGAAAAGG - Intergenic
950349120 3:12329604-12329626 ATAAAAAAAAATGATAGAATGGG - Intronic
950395916 3:12734081-12734103 TTAAAAAAAAATTGTAGAGATGG + Exonic
950997397 3:17518088-17518110 CTAAATAAAAACAGTAGAGTAGG + Intronic
951437776 3:22685014-22685036 TTGAATGAAAATCTTGGAGTTGG - Intergenic
951820383 3:26803602-26803624 TGAAAGGTAAATCATAGAGTGGG + Intergenic
952029869 3:29128797-29128819 TAAAAGAAAGATCTTAGAGTTGG - Intergenic
952118360 3:30211792-30211814 TAAAATAAAAATAATAAAGATGG + Intergenic
952443177 3:33354216-33354238 TTAAATAAAAATTTTAGGCTGGG + Intronic
953048593 3:39318408-39318430 AAAAAAAAAAATCATGGAGTTGG + Intergenic
953365340 3:42339888-42339910 TGACTTAAAAATTATAGAGTAGG - Intergenic
953892538 3:46763911-46763933 TTAAATAGAAAATCTAGAGTTGG + Intronic
953971234 3:47348883-47348905 TTTACTAAAAGTCATTGAGTTGG - Intergenic
954658583 3:52213527-52213549 GTACTTAAAAATCATAGACTTGG - Intronic
955012989 3:55037627-55037649 TTCTTTAAAAATCACAGAGTTGG - Intronic
955026477 3:55172332-55172354 TTAAAAGAAAATCACAGAGCTGG - Intergenic
955068550 3:55553392-55553414 TTAAATAAAATTCTTAATGTGGG - Intronic
955779638 3:62470763-62470785 TACAATAAGAATCATAGACTAGG + Intronic
956090788 3:65664623-65664645 TCAAATAAAATTCAGTGAGTAGG - Intronic
956898719 3:73691002-73691024 TAAAATAAAAGGCATACAGTTGG - Intergenic
956912289 3:73830684-73830706 TTAAATATAAATCTTAGATATGG + Intergenic
957010769 3:75003713-75003735 TAAAAAAAAAATCAGAAAGTGGG - Intergenic
957328844 3:78733168-78733190 TTAAATAAAAGTGATAATGTGGG + Intronic
957625931 3:82651700-82651722 ATAACAAAATATCATAGAGTGGG + Intergenic
958140913 3:89560913-89560935 ATAAAAAAAAAGCATATAGTTGG + Intergenic
958455677 3:94328000-94328022 TTAAATACAAATAAGACAGTAGG + Intergenic
958503082 3:94938808-94938830 TTAAATAAAAATTCTAGAATTGG - Intergenic
958689576 3:97446328-97446350 TGGAATAAAAATCAAACAGTAGG - Intronic
958707109 3:97669667-97669689 GTGTATAAAAATCATGGAGTGGG - Intronic
959134712 3:102403047-102403069 GTAAATAATAATAATAAAGTAGG - Intronic
959193743 3:103150063-103150085 TGTAATAATAATAATAGAGTAGG - Intergenic
959689782 3:109186363-109186385 TTAAATACAAAACCTAGAATAGG + Intergenic
959751103 3:109836521-109836543 TGGAATAAAAATCATATAATTGG + Intergenic
960102951 3:113764073-113764095 TTACATAAAAATCAAAAAGCTGG + Intronic
960329811 3:116344894-116344916 TAATATAGAAATCAAAGAGTGGG - Intronic
960345821 3:116531259-116531281 TTAAAGAAAATTAATAGATTAGG - Intronic
960394055 3:117114697-117114719 TTAAATAATAATTAAAGAGGGGG + Intronic
960483338 3:118220151-118220173 TTAAAGAAAAAACAAACAGTGGG - Intergenic
960540160 3:118853109-118853131 TTTTATAAAATTCATAGGGTGGG - Intergenic
960984465 3:123265378-123265400 TTTAAAAAAAAACATAGACTGGG - Intronic
961847252 3:129776284-129776306 TTATGTAAATAGCATAGAGTTGG + Intronic
962101537 3:132347776-132347798 TGAAATAAAAATTCTAGACTGGG - Intronic
962594306 3:136924401-136924423 TTAAATAAATGACATAGAGTGGG + Intronic
962669544 3:137690932-137690954 TTAAACAAAACTTACAGAGTTGG + Intergenic
963176229 3:142300323-142300345 TTAAAAAAAAAAAATAGAGATGG + Intergenic
963190457 3:142465708-142465730 TTAAAAACAAAGCATAGACTGGG + Intronic
963560425 3:146857402-146857424 ATAACAAAAAATCATAGACTGGG + Intergenic
963589574 3:147240781-147240803 TTATATAAACATCATAGATAAGG - Intergenic
963791367 3:149586257-149586279 TTAAATAAAAAAAAAAAAGTTGG - Intronic
964052675 3:152415639-152415661 GTAAATCAATATCATAGACTTGG + Intronic
964230053 3:154455427-154455449 TTATATAAAAATCACATACTGGG + Intergenic
964240133 3:154583006-154583028 TTAAAGAAAAAACACAGAATGGG + Intergenic
964656469 3:159072480-159072502 TTTAAAAAAAATTACAGAGTTGG + Intronic
964997419 3:162901227-162901249 TTAACTAAAAATCACAAAGAGGG + Intergenic
965267721 3:166567375-166567397 CTAAATGAAAATCATAGCTTAGG - Intergenic
965297911 3:166973187-166973209 TTAAATAAAAATATTATAATAGG - Intergenic
965372308 3:167878302-167878324 ATAAATACAAATCATAGCATGGG - Intergenic
965560924 3:170061976-170061998 TTATTTTAAAATCATAGAGATGG - Intronic
965734658 3:171808238-171808260 TTAAAAAAAAAAAATAGGGTCGG + Intronic
965911610 3:173784476-173784498 TTATATAAGAATCATGGGGTAGG - Intronic
966242514 3:177770169-177770191 TAAAATAAAAAGCATACAATAGG + Intergenic
967580236 3:191144635-191144657 TTATACAAAAAATATAGAGTGGG - Intergenic
969042540 4:4311019-4311041 TTAAATAAAACTAATGGAATGGG - Intronic
969161460 4:5262909-5262931 TGAAAGTAAAATCATTGAGTTGG + Intronic
970149855 4:13077972-13077994 TTATTTAAAAAACATAGAGAGGG - Intergenic
970190935 4:13516894-13516916 ATAATAAAAAAACATAGAGTAGG + Intergenic
970429344 4:15974496-15974518 TTAAATAAGAACCATGAAGTGGG - Intronic
970548299 4:17152874-17152896 CTAAATAAAAAAAATAAAGTTGG + Intergenic
970885313 4:20981359-20981381 TTAAAAGAAAATCATATAATGGG - Intronic
970974213 4:22024375-22024397 ATAAAAAAATGTCATAGAGTAGG + Intergenic
971085110 4:23266048-23266070 ATAAATAAATGACATAGAGTGGG - Intergenic
971241346 4:24891826-24891848 TTAAAAAAAAATTGTAGAGAAGG - Intronic
971536739 4:27761739-27761761 TAAAATAAAAATTTTAGGGTGGG - Intergenic
971731160 4:30382800-30382822 TTAAATAAACAAAATAGCGTTGG - Intergenic
971819652 4:31534885-31534907 TTTATTAAAATTCATAGAATTGG - Intergenic
971825698 4:31619617-31619639 CTGAAAAAAAATCATTGAGTGGG - Intergenic
972005689 4:34101093-34101115 CTAAACAGAAATCATAGTGTAGG + Intergenic
972256949 4:37366706-37366728 TTACATCAATATCATATAGTAGG + Intronic
972450037 4:39188028-39188050 TTAAATATAAATCAAAGTATGGG + Intronic
972488075 4:39561284-39561306 TAAAATAAAAATAATAGTATAGG - Intronic
972890182 4:43548538-43548560 TTAAATAATAATAATAGGCTGGG - Intergenic
973130525 4:46642671-46642693 TCAAAAAAAAATAATAAAGTAGG + Intergenic
973597622 4:52508556-52508578 TTGAATGAAAACAATAGAGTGGG + Intergenic
973964006 4:56141861-56141883 TTAAAAAAAAATTATAGAGATGG + Intergenic
974138415 4:57850222-57850244 TTAAATGAGAATAAGAGAGTGGG + Intergenic
974274505 4:59700506-59700528 ATAATTAAAAATGATAGAATTGG + Intergenic
974373477 4:61046515-61046537 TTAAACAAAAATCTCAGGGTAGG - Intergenic
974434397 4:61838646-61838668 TTAACTTAATATAATAGAGTTGG - Intronic
974592479 4:63971743-63971765 TGGAGTAAAAATCCTAGAGTTGG - Intergenic
974714754 4:65653349-65653371 TTAGATAAAAATCATTATGTAGG - Intronic
974773705 4:66451037-66451059 ATAAATAAATATCACAGACTGGG - Intergenic
974776768 4:66493688-66493710 TTGAATAACAATGATAGAATTGG - Intergenic
974928680 4:68334936-68334958 TTATATAAAAACAATTGAGTAGG - Intronic
975283733 4:72593385-72593407 TGAAATAAGAATAAAAGAGTTGG + Intergenic
975433376 4:74321310-74321332 TTAAATTCACATCATAGACTGGG + Intergenic
975915190 4:79316845-79316867 ATAAATAAAATGCAAAGAGTAGG + Exonic
976239951 4:82944706-82944728 TAAAAAAAAAATCAGAGATTTGG - Intronic
976807592 4:89065470-89065492 TTAATTAAAAAACATAAACTAGG + Intronic
976822540 4:89222850-89222872 TTTAAATAAAATCATACAGTGGG + Intergenic
977277262 4:94993034-94993056 TTAAATAAAAAACTTAAATTAGG - Intronic
977358427 4:95975644-95975666 TTAATTAAAATTCATAAAGTTGG - Intergenic
977999928 4:103545660-103545682 TAAAATAAAAATCATAAAAAAGG + Intergenic
978299792 4:107254819-107254841 TTGAATGAAAATCATAAATTTGG + Intronic
978731223 4:112029173-112029195 CTAAATAAAAATTATACATTTGG - Intergenic
978732975 4:112052334-112052356 TTTAATTAAAAATATAGAGTAGG - Intergenic
979065740 4:116130290-116130312 TAAAATAAAAATAAGAAAGTTGG + Intergenic
979123830 4:116940870-116940892 TTAAAAAAAAATCATTTATTAGG + Intergenic
979240861 4:118445873-118445895 CTACATAAAAATAATAAAGTGGG + Intergenic
979425955 4:120566630-120566652 TGAAATAATAATAAAAGAGTAGG - Intergenic
979435926 4:120690151-120690173 GAAAATAAAAAGTATAGAGTTGG + Intronic
979924877 4:126549441-126549463 CATAAAAAAAATCATAGAGTAGG + Intergenic
979945311 4:126823684-126823706 TTAAAAAAAAATCACTGAGCAGG + Intergenic
980052987 4:128056403-128056425 TTATATGAAAATCATAGGCTGGG - Intergenic
980899234 4:138888460-138888482 ATAACAAAATATCATAGAGTGGG - Intergenic
981352386 4:143746991-143747013 TTAAATATAAATGATGAAGTTGG - Intergenic
981485801 4:145284899-145284921 TTAAAAAAAAATCCTGGAGCAGG + Intergenic
981858080 4:149319208-149319230 TTGAATAAAAATCATTGCTTAGG + Intergenic
981887551 4:149694934-149694956 TTAAATAAAATTTAAATAGTGGG - Intergenic
982088314 4:151858766-151858788 TAAAATAACAATTATAGAGATGG - Intergenic
983146891 4:164227702-164227724 TTAAATTAACAACATTGAGTAGG - Intronic
984740085 4:183152898-183152920 ATAAATAAAAATAATAGAGTTGG + Intronic
985090495 4:186358032-186358054 TTAGATTAAAATTATAGATTGGG + Intergenic
985126152 4:186696726-186696748 TTAAATAAAAATTCTGGACTGGG + Intronic
985274983 4:188229454-188229476 TTTAAAAAAAATATTAGAGTGGG + Intergenic
985380238 4:189386597-189386619 TTAAAAAAAAATTATAGAGATGG + Intergenic
986491636 5:8297502-8297524 TTGAATAAAAAGGATAGAGCTGG - Intergenic
987429933 5:17820419-17820441 TTAATTAAACAGCATAGAGAAGG - Intergenic
987444583 5:18002055-18002077 TCAGAAAAAAATCATAGGGTGGG + Intergenic
987517175 5:18925914-18925936 TTGAATAAAAATAATAGAATTGG + Intergenic
988347290 5:30054449-30054471 TTAAATAAACATTATAGTGGAGG - Intergenic
989014010 5:36907824-36907846 TTAAATGAAAATCATCAAGATGG + Intronic
989145044 5:38240966-38240988 TCAAATAAATACCATACAGTGGG - Intergenic
989554979 5:42783506-42783528 TGAAATGAAAATCAAAGAGGAGG + Exonic
990105505 5:52253818-52253840 ATAAATAAAAATCCCAGACTTGG + Intergenic
990336770 5:54781122-54781144 TTAAATATAAAACATAAAGATGG + Intergenic
990661377 5:58019506-58019528 TTAAAAAAAAGTCAAAGATTTGG - Intergenic
990904295 5:60786957-60786979 TTAAAAAAAAAAAAAAGAGTTGG + Intronic
990927116 5:61038534-61038556 TCAAATAAACAAGATAGAGTTGG - Intronic
990963407 5:61418557-61418579 TTAAATAAAAATCATAGAGTAGG - Intronic
990975785 5:61560407-61560429 ATAAATAAATGTCATAGAGATGG - Intergenic
991150975 5:63369463-63369485 ACAAAAAAAAATCATATAGTTGG + Intergenic
991413734 5:66370126-66370148 ATAAATACAAATCATAGTCTAGG - Intergenic
991550467 5:67830492-67830514 TTAACTAAAAATAATGGAGGGGG - Intergenic
992603245 5:78426609-78426631 TTACTTAAAAATCATTGAATTGG - Intronic
992628341 5:78655407-78655429 TTAAAAAAGAAACATAGAGCTGG + Intronic
993097754 5:83499932-83499954 TTAGATAAACATCATCAAGTAGG + Intronic
993483327 5:88451461-88451483 ATAAATGAAAATGATAGAGGGGG - Intergenic
994065998 5:95543333-95543355 TTAAAAAAAATTAAAAGAGTAGG + Intronic
994407056 5:99358595-99358617 ATAAGCAAAAATCATAAAGTTGG + Intergenic
994475711 5:100266332-100266354 TTACATAAAAATGAAAAAGTTGG + Intergenic
994510366 5:100695729-100695751 TGAAATAAACATTATATAGTTGG - Intergenic
994558993 5:101343654-101343676 TAAAGAAAAAATGATAGAGTAGG + Intergenic
994579591 5:101623040-101623062 TTAAATAAAAATGATAAGCTAGG - Intergenic
994988751 5:106971540-106971562 GTAATGAAAAATCATACAGTTGG - Intergenic
995374704 5:111461032-111461054 TTAAATGAAAAACATGAAGTGGG + Intronic
995502342 5:112821203-112821225 TTAAATAGAAATTATAAACTGGG + Intronic
995680675 5:114715269-114715291 TTAAAAAAAAATCATAGGCCCGG - Intergenic
995728623 5:115210881-115210903 CTAATTAAAAAACATACAGTTGG + Exonic
995863670 5:116667248-116667270 TTAAACGAAAATCTCAGAGTAGG - Intergenic
996060425 5:119027113-119027135 TTAAAAAAAAATTATGGAGTAGG - Intergenic
996184861 5:120463588-120463610 TTAAAAAAAAAAAAAAGAGTTGG + Intergenic
996459028 5:123719885-123719907 TTAAACAAAAATAATCCAGTTGG + Intergenic
996611020 5:125380765-125380787 TTAAAAAAAAATTGTAGAGAAGG - Intergenic
997060679 5:130498806-130498828 TGAAATAAAGATCAGAGAGCAGG - Intergenic
997124882 5:131216172-131216194 TAAAATAAAAGTCATAGTCTAGG + Intergenic
997491608 5:134281821-134281843 TCAAAAAAAAATCATATAGATGG + Intergenic
997562238 5:134856922-134856944 TTAATTAAAAATCTTATTGTGGG + Exonic
997793279 5:136782346-136782368 TTAAATCAGAATCACAGAGTAGG - Intergenic
998311144 5:141133933-141133955 TGAAATAAAAACCATAGAGTGGG + Intronic
998647517 5:144079322-144079344 TTAAAAAAAAAACATTGAGGAGG + Intergenic
998912625 5:146976763-146976785 TTAAATAAGAATAATAGTGAGGG - Intronic
999202900 5:149828872-149828894 AAAAAAAAAAATCATAGAGATGG - Intronic
999532435 5:152479076-152479098 TAAAAAAAAAATTATAGAGATGG + Intergenic
1000045563 5:157519314-157519336 ATAAATAAAAATTAAAAAGTGGG - Intronic
1000346118 5:160315173-160315195 TTAAATAAAAAGGATAAACTGGG + Intronic
1000374875 5:160570161-160570183 TTAAATAAAAATAAAAGACAAGG - Intronic
1000470532 5:161634629-161634651 CTAATAAAAAATCCTAGAGTTGG - Intronic
1000866498 5:166521082-166521104 CTAAGTAAAAATTATAGAGATGG + Intergenic
1000921982 5:167149173-167149195 TTAAATGAAAATATTAGGGTGGG - Intergenic
1001107459 5:168867256-168867278 TTAGAGAAAAATTCTAGAGTAGG + Intronic
1001319703 5:170670461-170670483 TAAACTATAAATTATAGAGTTGG + Intronic
1001560801 5:172667815-172667837 TTAAAGAAAAATCAAACAATAGG + Intronic
1001859594 5:175042107-175042129 TTAAAAAAAAATCATTGTGCAGG - Intergenic
1002126369 5:177047948-177047970 TTAAATAAAAAACATATAGAAGG - Intronic
1002477171 5:179473870-179473892 TTAATTAAAAATTGTAGAGATGG - Intergenic
1003228412 6:4227171-4227193 ATAAATAAAAATAATAAAATGGG + Intergenic
1003313796 6:4993047-4993069 TTAAATAAAAGTCATAGTGTAGG - Intergenic
1003644224 6:7901436-7901458 TTACAAAAAAATCATAGGCTAGG - Intronic
1003744375 6:8983202-8983224 AGGAATAAAAATCATAGCGTTGG - Intergenic
1004046885 6:12034331-12034353 CTTAATAAAACTCATAGATTCGG - Intronic
1004459599 6:15823382-15823404 TTAAATAAAGATTATAGAGAAGG - Intergenic
1004835215 6:19523209-19523231 TATAATAAATGTCATAGAGTAGG - Intergenic
1005109429 6:22263711-22263733 TTAAACAAAAATAATATGGTAGG - Intergenic
1005255062 6:23993194-23993216 TAAAATGAAAATCATAGAAATGG - Intergenic
1005519550 6:26587428-26587450 TTAAATAAGAATTACAAAGTTGG - Intergenic
1005618511 6:27598433-27598455 TTAAATAAAAATAATCAAGTAGG + Intergenic
1005713567 6:28525582-28525604 TTAAAAATAAATCAAAGAATGGG - Intronic
1006256081 6:32833445-32833467 TTAAAAAAAAATCAGAAAATGGG + Intronic
1006827027 6:36942634-36942656 TTAAAAAAAAATTATAGAGATGG - Intergenic
1008302475 6:49858234-49858256 TTAACTAAAAATAAAAGAGAAGG - Intronic
1008576758 6:52868114-52868136 TTTAATAAAAATCATTTGGTTGG - Intronic
1008715531 6:54284668-54284690 CTAAGTAAAAATGATTGAGTGGG + Intergenic
1008766353 6:54920748-54920770 TACAATAAAAATCATACAGAAGG + Intronic
1008794967 6:55292143-55292165 CTAGCTAAAAATCTTAGAGTGGG - Intergenic
1008974671 6:57410705-57410727 ATAAATAAAAGGCATACAGTTGG - Intronic
1009163556 6:60312211-60312233 ATAAATAAAAGGCATACAGTTGG - Intergenic
1009212673 6:60881680-60881702 AGAAAAAAAAATCATAGAGGGGG - Intergenic
1009598749 6:65771347-65771369 TTAAATAAAATATATAGATTGGG + Intergenic
1009669694 6:66730857-66730879 ATAAAGAAATATCTTAGAGTGGG - Intergenic
1009742270 6:67760987-67761009 GTAAAAAAAAAAAATAGAGTTGG + Intergenic
1010114613 6:72287910-72287932 GTAAATATACATAATAGAGTAGG + Intronic
1010232908 6:73551244-73551266 TTAAATAAAAATAACAGGCTGGG + Intergenic
1010496871 6:76544266-76544288 TTCAATATTAATAATAGAGTAGG - Intergenic
1010581235 6:77598853-77598875 TAAAATATAAGTAATAGAGTTGG + Intergenic
1010638538 6:78291104-78291126 TTAAAAAGAAATCATAAAATTGG + Intergenic
1010814155 6:80336424-80336446 TTAAATAAAAATCCTAATTTAGG + Intronic
1011257369 6:85436730-85436752 TCATATATATATCATAGAGTAGG + Intergenic
1011455658 6:87545813-87545835 TTTAGTAAAAAACATTGAGTTGG - Intronic
1011713387 6:90078316-90078338 TTAAATAAAAAACAGGGAGAAGG + Intronic
1012432306 6:99176884-99176906 TTAAATATAAATCATATAACAGG + Intergenic
1012617138 6:101291174-101291196 TTAAATTAAAATGAGAAAGTTGG + Intergenic
1012620027 6:101332092-101332114 TTAAATAAAAAGTAAAGAGAAGG - Intergenic
1012685168 6:102237821-102237843 TTAAATAAACACCCTTGAGTAGG + Intergenic
1012870214 6:104664064-104664086 GCAAATAAAAACCATAAAGTGGG + Intergenic
1013721615 6:113036890-113036912 TGAAATAAAACGCAGAGAGTTGG + Intergenic
1013871863 6:114773271-114773293 TTGAATAAAATGCATATAGTTGG + Intergenic
1013952504 6:115801262-115801284 TTAAAAAAAAATCATTTAGAAGG + Intergenic
1013982903 6:116154476-116154498 TAACATAAAAATCACAGAGCAGG - Intronic
1014334307 6:120113391-120113413 TGTAATAAAATTCATAGAGATGG + Intergenic
1014436106 6:121422160-121422182 AGAAATAAAAGGCATAGAGTTGG + Intergenic
1014772335 6:125471219-125471241 TTCAAAAAAAATCATAAAGTTGG + Intergenic
1014800580 6:125773261-125773283 ATAAATAAAAATAAAATAGTGGG - Intergenic
1014983274 6:127971614-127971636 TTAAACACAAATCAGAGGGTGGG + Intronic
1015100354 6:129471085-129471107 TTAAATAATAGACACAGAGTAGG - Intronic
1015137354 6:129888422-129888444 TTAACTAAAAATAATAGGGCTGG - Intergenic
1015166518 6:130205890-130205912 TGACACAAAAATCATACAGTAGG + Intronic
1015249762 6:131114545-131114567 TTAAAGAAAAAGCCTACAGTGGG - Intergenic
1016209665 6:141514656-141514678 AGAAATAAAAATCATGCAGTTGG + Intergenic
1016266961 6:142243978-142244000 GTAAATAAAAATCAAAGAAAAGG + Intergenic
1016548710 6:145253208-145253230 TTCGATAAAAATCATGGATTGGG + Intergenic
1016773402 6:147877081-147877103 TTAAAAAAAAATCATTGATAAGG + Intergenic
1016961710 6:149679028-149679050 TTAAATAAAGGTTAAAGAGTAGG + Intronic
1016990917 6:149927194-149927216 TAAAATAAAAATCATATATCAGG - Intergenic
1017072464 6:150587798-150587820 TGGAATAAAAATCATAGTGGTGG + Intergenic
1017137999 6:151165012-151165034 AAAAATAAAAATTACAGAGTAGG + Intergenic
1017147248 6:151245695-151245717 TTAAATAAAAATCATTAATAAGG - Intronic
1017162214 6:151375880-151375902 TTAAAAAAGAACCATAAAGTGGG + Intronic
1017179104 6:151533352-151533374 TTAAATAAGAATGAAATAGTCGG - Intronic
1017217339 6:151924394-151924416 TTAATTAAAAAAAATACAGTTGG - Intronic
1017358181 6:153534705-153534727 TATAATAAAAAACATAGATTTGG - Intergenic
1018466305 6:164048862-164048884 TTAAATAAAAATTAGTGAGAAGG + Intergenic
1018827088 6:167416268-167416290 TTAAATAAAAATCCTAACGAAGG - Intergenic
1018885560 6:167932971-167932993 TTAAATAAGAAGCATACAGAAGG - Intronic
1020147069 7:5652790-5652812 TTAAAAAAAAGACAAAGAGTTGG + Intronic
1020335668 7:7060411-7060433 ATTAAAAAAAATCACAGAGTGGG + Intergenic
1020597718 7:10229909-10229931 TTAAAAAAAAATCATACAAAAGG + Intergenic
1020811632 7:12856131-12856153 TTAAATAAACACAAAAGAGTTGG + Intergenic
1020957353 7:14757935-14757957 TTAAATAAAAACAATACAGCTGG + Intronic
1021171899 7:17407353-17407375 TTAAAGAAAAAGAATAAAGTTGG + Intergenic
1021260818 7:18454770-18454792 TTAAATAAAATTCATATAATTGG - Intronic
1021514449 7:21467923-21467945 TTTAATAATAATCATACAGCAGG - Intronic
1021539944 7:21746431-21746453 TTAAAAAAAAATTGTAGAGATGG - Intronic
1023231820 7:38039962-38039984 TGAAAAATAAATTATAGAGTTGG + Intergenic
1023457773 7:40360307-40360329 TTAAAAAAAAATCTTAGGCTGGG - Intronic
1023652515 7:42386910-42386932 TTAAATGTGAATCATAGATTGGG - Intergenic
1023664556 7:42509302-42509324 TTAAAAAAAAATTTTAGAGATGG - Intergenic
1023959518 7:44914678-44914700 TTTGATAAAAATAGTAGAGTGGG + Intergenic
1024822466 7:53349210-53349232 TTATATAAATATCATACAGAAGG + Intergenic
1026155780 7:67824433-67824455 TAAAATAAAAAACATTGACTTGG + Intergenic
1026458162 7:70590940-70590962 TTAAATAAAAATAATGTAGTGGG - Intronic
1026580661 7:71613781-71613803 AAAAAAAAAAATCATAGAGATGG - Intronic
1026640824 7:72123828-72123850 TTAAAACAAAATGAGAGAGTCGG - Intronic
1026704062 7:72674477-72674499 TAAAAAAAAAATCTTTGAGTTGG - Intronic
1027394908 7:77744334-77744356 TTAAAAAAAAGTCAAACAGTAGG - Intronic
1027531023 7:79332820-79332842 TTAACCAAAAATAATAGATTGGG - Intronic
1027696558 7:81418651-81418673 ATAAATTAAAATCACAGAATTGG - Intergenic
1027712837 7:81629476-81629498 TTAAAGAAAAATAATATTGTTGG + Intergenic
1027740483 7:81996870-81996892 TTCAGTAAAAATCATAGAGATGG - Intronic
1027799332 7:82732557-82732579 TTAAATAAAATTTGTAGAGTTGG + Intergenic
1027801206 7:82751882-82751904 TTAAATAGAAATGATACAATAGG + Intergenic
1027906496 7:84190691-84190713 ATATATATAAATAATAGAGTGGG - Intronic
1028028979 7:85884807-85884829 TCTTATAAAAATCATACAGTTGG - Intergenic
1028869017 7:95745921-95745943 AAAAATGAAAACCATAGAGTGGG - Intergenic
1029020368 7:97358591-97358613 TCAAATAAAAAAAAGAGAGTCGG + Intergenic
1029104885 7:98167108-98167130 TTAAATGGAAATGATAGGGTGGG + Intronic
1029539405 7:101173879-101173901 ATAAATAAAAAGCCGAGAGTAGG - Intronic
1030013677 7:105197065-105197087 ATAAATCAAAGTCATAGACTCGG + Intronic
1030274736 7:107708681-107708703 TAAAAAAAAAATAATAGAGACGG - Intronic
1030321730 7:108176199-108176221 TTACATTAAAATCTTAGTGTGGG - Intronic
1030357986 7:108564011-108564033 TTTAAGAAAAACCAGAGAGTTGG - Exonic
1030383000 7:108834743-108834765 TTGAATAAAAATGGTAAAGTGGG + Intergenic
1030693335 7:112557365-112557387 TAGAATAAAAATAATACAGTGGG - Intergenic
1031006936 7:116483817-116483839 TTATCTAAAAATCTTGGAGTTGG - Intronic
1031165769 7:118225164-118225186 TTAAATAAAAAGCCGAAAGTTGG - Intronic
1031303848 7:120098899-120098921 TTAAATAAAAACCAAACATTTGG - Intergenic
1031328253 7:120429764-120429786 TCAAGTAAAAATCAGAAAGTTGG + Intronic
1032064517 7:128756183-128756205 ATAAATACAAAGCAAAGAGTAGG + Intronic
1032247722 7:130227136-130227158 TTAAATAATAAACAGAAAGTTGG + Intergenic
1032444472 7:131970069-131970091 TTTAAAAAAAATTATAGAGGGGG - Intergenic
1033842411 7:145390550-145390572 TTGAAATAAAATCATAGAGATGG + Intergenic
1034080053 7:148268356-148268378 TATAATAAAAATAATAGACTGGG + Intronic
1035084238 7:156243494-156243516 ATAAATAAAAAACAAAAAGTTGG - Intergenic
1035148420 7:156844020-156844042 TGAAATAAAAGTCATACATTAGG + Intronic
1035160499 7:156946637-156946659 TTAAAAAAAAATCCTTGAGTGGG + Intergenic
1036080527 8:5550349-5550371 TGAAATAAAAATAAAAAAGTGGG - Intergenic
1036080648 8:5552054-5552076 TAAAATAAAAAAAATAGAGATGG + Intergenic
1036922991 8:12875626-12875648 TTAAAAAAAAAAAAAAGAGTAGG - Intergenic
1037271929 8:17139827-17139849 TTAAAAAAAAAACTAAGAGTGGG - Intergenic
1037830689 8:22186980-22187002 TTAAATAAAATTAAAAGATTAGG - Intronic
1038709091 8:29924373-29924395 TTAAAAAAAAATCTTAGAATGGG - Intergenic
1039075507 8:33687587-33687609 TGAAATAAATAACATAGACTAGG + Intergenic
1039196566 8:35038846-35038868 TTAAATAAGCATCATTGAGGAGG + Intergenic
1039451161 8:37676145-37676167 TTAAAAAAAAATTAGAGACTGGG + Intergenic
1039664532 8:39510537-39510559 TTAAAAAAGAATAATAAAGTGGG + Intergenic
1039690629 8:39861208-39861230 TTAAAAAAATACCATAGACTGGG + Intergenic
1040142966 8:43947419-43947441 TCAAATAAAAATCAGACAGAAGG + Intergenic
1040469222 8:47723176-47723198 TTATATAAACAACATATAGTTGG + Intronic
1040629224 8:49190394-49190416 TTTAATAGACAACATAGAGTTGG - Intergenic
1040836279 8:51734882-51734904 TGAAATAAACATAATAGGGTTGG + Intronic
1040922951 8:52644025-52644047 ATAAATAAAATACATAGAGATGG - Intronic
1040932833 8:52753173-52753195 TAAAAAAAAAATTATAGAGATGG - Intergenic
1041063357 8:54058240-54058262 TTTAAAAAAAATCACAGAATTGG + Intronic
1041104372 8:54426937-54426959 TAAAATAAAAATGAGAGACTTGG + Intergenic
1041170565 8:55137957-55137979 TTTAATACAAATAATACAGTTGG - Intronic
1041665299 8:60438602-60438624 TTAAGTAAAAATCATGTAATTGG - Intergenic
1041703794 8:60822799-60822821 TTAAAAAAAAATCAAAGTCTTGG + Intronic
1042764923 8:72310541-72310563 TTAAAAAAAAATCAAAAAGTGGG - Intergenic
1042939850 8:74096576-74096598 TTATAGAAAAATAATAGAGCAGG - Intergenic
1043076298 8:75705494-75705516 TTAAAAAAAAATCAGAGACGAGG + Intergenic
1043264062 8:78240226-78240248 TTAAATAAAAATTTAAAAGTAGG + Intergenic
1043287755 8:78555908-78555930 ATAAAACAAAATCATAGTGTTGG - Intronic
1043858404 8:85287921-85287943 TCAAATAAAATTTACAGAGTGGG - Intergenic
1044069828 8:87744185-87744207 TTAAATAAGAATGAAACAGTAGG + Intergenic
1044241284 8:89891847-89891869 TTAAATATAAAACCCAGAGTTGG - Intergenic
1044804843 8:95995160-95995182 TAAAATAAAAAGGATAGCGTAGG - Intergenic
1045613448 8:103876368-103876390 TTAAAAAAAAACCATACACTGGG - Intronic
1045671159 8:104554353-104554375 TAAAAAAAAAATCTTAAAGTTGG - Intronic
1046331759 8:112725251-112725273 CTAAACTAAAATCTTAGAGTAGG + Intronic
1046362175 8:113174436-113174458 TTAATAACAAATAATAGAGTTGG - Intronic
1047063560 8:121254775-121254797 TTAAAAAAAAATCAAAGATAGGG + Intergenic
1047137503 8:122097011-122097033 TCAAATAAACATTATAAAGTGGG - Intergenic
1047626471 8:126661025-126661047 TTAAATAAAAATATTATAGTGGG + Intergenic
1047841583 8:128759775-128759797 TTAAATAACAGTGGTAGAGTGGG - Intergenic
1048012300 8:130467668-130467690 TGAAAAATAAATCATGGAGTTGG + Intergenic
1048123812 8:131610806-131610828 TTCTATAATAATCATAGAATTGG - Intergenic
1048152395 8:131906423-131906445 TTTAATTAAAATCAAAGGGTTGG + Intronic
1048738674 8:137530702-137530724 ATAAAGAAATATCATAGACTGGG - Intergenic
1048966299 8:139617224-139617246 ATAAATAAGAATTATAGTGTTGG - Intronic
1049015445 8:139916803-139916825 TTAAATACAAATCAAGGAGTCGG + Intronic
1050504472 9:6333036-6333058 TTTCATAAAGATGATAGAGTGGG + Intergenic
1050675489 9:8048023-8048045 GTAAAGAAAAAACATAAAGTGGG + Intergenic
1051966234 9:22833015-22833037 ATAAATAAAAAACAGAGAATTGG + Intergenic
1052112617 9:24606554-24606576 TTAAATAGCATTCATAAAGTTGG - Intergenic
1052434224 9:28405811-28405833 TCATATAAAAACCATAGAGAAGG - Intronic
1052523695 9:29584984-29585006 AAAAAAAAAAATCAAAGAGTGGG + Intergenic
1052701673 9:31945021-31945043 ATAAAGAAATATCAGAGAGTGGG - Intergenic
1052756220 9:32545012-32545034 TTCACTAAAAATCATAGGATTGG - Intronic
1052826163 9:33176829-33176851 TTAAAAAAAAATGTTAGATTTGG - Intergenic
1053174509 9:35912286-35912308 TAAAATAAAAATAATAAAATAGG - Intergenic
1053410371 9:37912461-37912483 TTAAAAAAAGATCATATTGTAGG + Intronic
1054931526 9:70640321-70640343 TTAAAGACAACTCATAGAGATGG + Intronic
1054993650 9:71359540-71359562 TGAAAAAAAAATCATGCAGTAGG - Intronic
1055191360 9:73528511-73528533 ATAAATAAAAATTATCAAGTTGG + Intergenic
1055261674 9:74443834-74443856 TGAAATAAAAATTATAGCTTTGG - Intergenic
1055958808 9:81800098-81800120 TTTAAAAATAATCATAAAGTAGG - Intergenic
1056218688 9:84429932-84429954 TTAAATAAAAATCACTGATGTGG + Intergenic
1056282849 9:85058834-85058856 TTTAATAATAATAATAGAGAAGG - Intergenic
1056868332 9:90251743-90251765 TGAAATACAAACCAAAGAGTTGG - Intergenic
1056919788 9:90776387-90776409 TTAAATAAAAAATATAAAGCTGG + Intergenic
1058058245 9:100470748-100470770 TTAAATAAAAAGCAAAAAATCGG - Intronic
1058293701 9:103278040-103278062 AAAAATAAAAATCATAGATGAGG - Intergenic
1058681672 9:107445787-107445809 TTAAATAAAAAAGACATAGTAGG + Intergenic
1058736344 9:107897672-107897694 TTAAAAAAAAATCACACATTGGG + Intergenic
1058886510 9:109325657-109325679 TTAATTAAAGACCATATAGTAGG + Intergenic
1058936684 9:109776176-109776198 TTAAATAAATAGCATAGTTTGGG + Intronic
1059224285 9:112657391-112657413 TAAACTCAAAATCGTAGAGTGGG - Intronic
1059846615 9:118285579-118285601 TTAATTAAAAATAAAAGAGAAGG + Intergenic
1061472782 9:130840688-130840710 TTAATTAAAAAAAATAGAGATGG + Intronic
1186368043 X:8915981-8916003 TTAAATACAAATTTTAGATTAGG + Intergenic
1186438532 X:9564973-9564995 CTAAAAAAAAATCATAGGCTGGG + Intronic
1186735706 X:12461812-12461834 TTTAGTAAAAGTCATACAGTAGG - Intronic
1186999171 X:15157398-15157420 TAAAATAAAAAATAAAGAGTGGG + Intergenic
1187691098 X:21867603-21867625 TTAAAAAAAAATAATAAAGACGG + Intronic
1187766802 X:22651623-22651645 TTAAATCAAGATCGTAAAGTTGG + Intergenic
1187786056 X:22887699-22887721 TATAATAAAAATCATATATTTGG - Intergenic
1187842546 X:23504210-23504232 TTAAGTTAAAATAATAGAGTTGG + Intergenic
1187874841 X:23795641-23795663 ATAAATAAAAATAAAAGAATGGG - Intergenic
1188005673 X:25014271-25014293 GGAAATAAAAATGAGAGAGTAGG - Intronic
1188572614 X:31606355-31606377 TCAAATATAAATCATATAGGTGG + Intronic
1188713374 X:33429951-33429973 AAATATAAAAATCAAAGAGTTGG + Intergenic
1188927488 X:36062803-36062825 TTAAAATATAATCACAGAGTTGG - Intronic
1189404046 X:40702183-40702205 TTAACAAAATATCATAGACTAGG - Intronic
1189567700 X:42260439-42260461 TTAAAATAAAATCAGAGACTAGG + Intergenic
1189631951 X:42963840-42963862 TTCAAGAAAAATCATAGAAAAGG - Intergenic
1189688367 X:43589408-43589430 TTAAAAAAAAAAAAAAGAGTGGG + Intergenic
1189717242 X:43879421-43879443 TTAAACATAAATCATTGTGTTGG + Intronic
1190963875 X:55279150-55279172 GTAAATAACAATCATTGAGAGGG + Intronic
1191587696 X:62846697-62846719 TTTAATAAAAATAATACAATGGG - Intergenic
1191594395 X:62926297-62926319 TTATATTGAAAACATAGAGTGGG + Intergenic
1191994453 X:67076706-67076728 TCAAACAAAAAACATAAAGTGGG + Intergenic
1192722541 X:73714528-73714550 TAAAATTAAATTCAAAGAGTTGG - Intergenic
1193513857 X:82438879-82438901 TTAAACAAAAAGAATAGAGCTGG + Intergenic
1193677841 X:84478681-84478703 TTAAAAAAAAATTGTAGAGGTGG - Intronic
1194168057 X:90546505-90546527 TTGAAGAAAAATAATAAAGTTGG + Intergenic
1194317894 X:92404674-92404696 TTAAGGAAAAATTATATAGTAGG + Intronic
1194416575 X:93619449-93619471 TTAATTAAAAAGCATAGAGGAGG + Intergenic
1194419396 X:93654529-93654551 TGAAATAAAAATCATACTGCTGG + Intergenic
1194597482 X:95876575-95876597 TTATATGAAAATAATATAGTAGG - Intergenic
1194683992 X:96889409-96889431 TGGAATAAATATCATAGAGATGG - Intronic
1194740739 X:97571111-97571133 TTAAAGAAAAAACAGAGACTTGG - Intronic
1195200117 X:102541370-102541392 TTTGCTAAAAATCATAAAGTGGG + Intergenic
1195342901 X:103922170-103922192 TTAAATAAAAATGAGATAATAGG - Intronic
1195387469 X:104326495-104326517 TTTAATAGAAGTCATACAGTTGG - Intergenic
1195843712 X:109203496-109203518 TAAAAAAAAAATCAAAAAGTGGG - Intergenic
1196006014 X:110838103-110838125 TTAAAAAAAAATCACAGTGCAGG + Intergenic
1196212810 X:113014026-113014048 TTAAAAAAAAATTGTAGAGATGG + Intergenic
1196377504 X:115050285-115050307 TTAAAAAAAATTCATAGATGAGG - Intergenic
1197134374 X:123043977-123043999 TTTAATAAAAATCATATGGCTGG - Intergenic
1197379622 X:125723445-125723467 TTAAAGAAACATGATATAGTGGG - Intergenic
1197494675 X:127163224-127163246 TTCCATAAAAATTATAGAATTGG + Intergenic
1197521591 X:127505128-127505150 TTAAATAAAGATAATAGACATGG - Intergenic
1197801948 X:130359668-130359690 TTAAATAAAAATGAGAGCTTTGG + Intronic
1197930831 X:131694363-131694385 TTACACAAAGATCATAGATTTGG + Intergenic
1198011398 X:132559213-132559235 TTAAAAAAAAATTGTAGAGATGG - Intergenic
1198201524 X:134424175-134424197 TTAAATAAAAATCGTAATATAGG - Intronic
1198351641 X:135810916-135810938 TTTAAAAAAAAGCATAGAATGGG + Intergenic
1198355457 X:135845434-135845456 TTTAAAAAAAAGCATAGAATGGG + Intergenic
1198357367 X:135862719-135862741 TTTAAAAAAAAGCATAGAATGGG + Intergenic
1198407407 X:136327436-136327458 TAAAATAAAAAGGACAGAGTGGG + Intronic
1198654825 X:138901825-138901847 TTAAACAAAAGGCATGGAGTAGG + Intronic
1199340267 X:146669380-146669402 TTATAGAAAAAGCATAGAGAGGG - Intergenic
1199903551 X:152201830-152201852 ATAAAGAAAAATCAGAGAGATGG - Intronic
1199994199 X:153009512-153009534 TGATTTAAAAATCAAAGAGTTGG + Intergenic
1200514307 Y:4124287-4124309 TTGAAGAAAAATAATAAAGTTGG + Intergenic
1200626069 Y:5517970-5517992 TTAAGGAAAAATTATATAGTAGG + Intronic
1201688029 Y:16728950-16728972 TAAATTAAAAATCATAGTATGGG - Intergenic