ID: 990963409

View in Genome Browser
Species Human (GRCh38)
Location 5:61418592-61418614
Sequence AGTGACTATCTAGATGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990963405_990963409 17 Left 990963405 5:61418552-61418574 CCCGGCCTACTCTATGATTTTTA 0: 1
1: 2
2: 30
3: 194
4: 1322
Right 990963409 5:61418592-61418614 AGTGACTATCTAGATGAGTGAGG No data
990963404_990963409 25 Left 990963404 5:61418544-61418566 CCACTGTGCCCGGCCTACTCTAT 0: 1
1: 19
2: 197
3: 1716
4: 8327
Right 990963409 5:61418592-61418614 AGTGACTATCTAGATGAGTGAGG No data
990963407_990963409 12 Left 990963407 5:61418557-61418579 CCTACTCTATGATTTTTATTTAA 0: 1
1: 0
2: 6
3: 76
4: 885
Right 990963409 5:61418592-61418614 AGTGACTATCTAGATGAGTGAGG No data
990963406_990963409 16 Left 990963406 5:61418553-61418575 CCGGCCTACTCTATGATTTTTAT 0: 1
1: 0
2: 8
3: 93
4: 725
Right 990963409 5:61418592-61418614 AGTGACTATCTAGATGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990963409 Original CRISPR AGTGACTATCTAGATGAGTG AGG Intronic
No off target data available for this crispr