ID: 990963410 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:61418593-61418615 |
Sequence | GTGACTATCTAGATGAGTGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
990963406_990963410 | 17 | Left | 990963406 | 5:61418553-61418575 | CCGGCCTACTCTATGATTTTTAT | 0: 1 1: 0 2: 8 3: 93 4: 725 |
||
Right | 990963410 | 5:61418593-61418615 | GTGACTATCTAGATGAGTGAGGG | No data | ||||
990963407_990963410 | 13 | Left | 990963407 | 5:61418557-61418579 | CCTACTCTATGATTTTTATTTAA | 0: 1 1: 0 2: 6 3: 76 4: 885 |
||
Right | 990963410 | 5:61418593-61418615 | GTGACTATCTAGATGAGTGAGGG | No data | ||||
990963405_990963410 | 18 | Left | 990963405 | 5:61418552-61418574 | CCCGGCCTACTCTATGATTTTTA | 0: 1 1: 2 2: 30 3: 194 4: 1322 |
||
Right | 990963410 | 5:61418593-61418615 | GTGACTATCTAGATGAGTGAGGG | No data | ||||
990963404_990963410 | 26 | Left | 990963404 | 5:61418544-61418566 | CCACTGTGCCCGGCCTACTCTAT | 0: 1 1: 19 2: 197 3: 1716 4: 8327 |
||
Right | 990963410 | 5:61418593-61418615 | GTGACTATCTAGATGAGTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
990963410 | Original CRISPR | GTGACTATCTAGATGAGTGA GGG | Intronic | ||
No off target data available for this crispr |