ID: 990963411

View in Genome Browser
Species Human (GRCh38)
Location 5:61418594-61418616
Sequence TGACTATCTAGATGAGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990963404_990963411 27 Left 990963404 5:61418544-61418566 CCACTGTGCCCGGCCTACTCTAT 0: 1
1: 19
2: 197
3: 1716
4: 8327
Right 990963411 5:61418594-61418616 TGACTATCTAGATGAGTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 130
990963407_990963411 14 Left 990963407 5:61418557-61418579 CCTACTCTATGATTTTTATTTAA 0: 1
1: 0
2: 6
3: 76
4: 885
Right 990963411 5:61418594-61418616 TGACTATCTAGATGAGTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 130
990963405_990963411 19 Left 990963405 5:61418552-61418574 CCCGGCCTACTCTATGATTTTTA 0: 1
1: 2
2: 30
3: 194
4: 1322
Right 990963411 5:61418594-61418616 TGACTATCTAGATGAGTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 130
990963406_990963411 18 Left 990963406 5:61418553-61418575 CCGGCCTACTCTATGATTTTTAT 0: 1
1: 0
2: 8
3: 93
4: 725
Right 990963411 5:61418594-61418616 TGACTATCTAGATGAGTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990963411 Original CRISPR TGACTATCTAGATGAGTGAG GGG Intronic
903262423 1:22138675-22138697 TGACTATTTAGAGGGGAGAGAGG + Intronic
903359839 1:22770003-22770025 TGAATAGATAGATGGGTGAGTGG + Intronic
909786303 1:79618107-79618129 TGACTACTTAGAAGAGTGATAGG + Intergenic
910301532 1:85711990-85712012 GGAATATATAGATAAGTGAGGGG + Intergenic
911160053 1:94675015-94675037 TGAATAGATACATGAGTGAGTGG + Intergenic
914424330 1:147560907-147560929 TGACTCTCTTTATGAGTAAGAGG - Intronic
915251498 1:154592484-154592506 TGACAGTCTAGATGAGACAGTGG + Intronic
916848074 1:168673674-168673696 CTTCTATCTAGTTGAGTGAGGGG + Intergenic
920863885 1:209735270-209735292 TAAATGTCTAAATGAGTGAGTGG - Intergenic
924665773 1:246070076-246070098 AGACTATCTTGAAGGGTGAGAGG + Intronic
1063859701 10:10294301-10294323 TGTGTATATATATGAGTGAGTGG + Intergenic
1068206565 10:53862506-53862528 AGACTTTCTTGATGAGTCAGTGG - Intronic
1068699623 10:60006085-60006107 TGAATAAGTAGATGAATGAGTGG + Intergenic
1074512807 10:114133261-114133283 TGACTGGTTAGATGTGTGAGGGG + Intronic
1074888838 10:117718058-117718080 TGATTCTCAAGATGAGTGATGGG - Intergenic
1074956084 10:118391325-118391347 TGACTATGTAAATGAATAAGTGG - Intergenic
1075386611 10:122059903-122059925 TGAGTTTCTAGTTCAGTGAGTGG - Intronic
1077357486 11:2125335-2125357 TGAATAGATAGATGAGTGGGTGG + Intergenic
1077357618 11:2125987-2126009 TGAATAGATAGATGAGTGGGTGG + Intergenic
1077357654 11:2126175-2126197 TGAGTAGATAGATGAGTGGGTGG + Intergenic
1077901204 11:6490471-6490493 TGAATATATAGATGAATGTGGGG - Intronic
1080936685 11:36871025-36871047 TGACTGTATAGATAAATGAGAGG + Intergenic
1083376526 11:62227585-62227607 TGGCTTTCTAGATGAATCAGAGG + Intergenic
1084869217 11:72085115-72085137 TGACTAACTTGATGAATGACAGG - Intronic
1085262610 11:75216357-75216379 TGAATATGTGGATGAGTGAGTGG + Intergenic
1092101231 12:5885206-5885228 TAACTTTCTATATGAGTCAGGGG - Intronic
1093699005 12:22196681-22196703 AGACTATCCATATGAATGAGGGG + Exonic
1094729229 12:33155809-33155831 AGATTATATAGATGAGTTAGTGG - Intergenic
1095876439 12:47083856-47083878 AGACCAACCAGATGAGTGAGTGG - Intronic
1096012770 12:48235219-48235241 GGGCTATGGAGATGAGTGAGTGG - Intergenic
1098941903 12:76547657-76547679 AGTGTATCTAGATGGGTGAGGGG - Intronic
1101757213 12:107630309-107630331 TGAATATGTAGCTTAGTGAGTGG + Intronic
1102504229 12:113373731-113373753 TAGATATGTAGATGAGTGAGTGG - Intronic
1106305110 13:28502734-28502756 TTACTATCTATATGATGGAGAGG + Intergenic
1109412800 13:61995439-61995461 TAACTATCTAGATCAGAGATAGG - Intergenic
1110649610 13:77927695-77927717 TGAATATCTAGATTAATGAATGG - Intergenic
1113912704 13:113851550-113851572 TGAGTGGATAGATGAGTGAGTGG + Intronic
1118086212 14:62420415-62420437 TCACTATCTAGTTGTGTGATTGG + Intergenic
1118236343 14:64008652-64008674 TTACTATCTACATGAGGGTGGGG + Intronic
1120153437 14:81064138-81064160 TGGCTATGTAGTGGAGTGAGGGG + Intronic
1122019312 14:98823377-98823399 TGACTAGCTAGATGAGGGGCTGG - Intergenic
1125309875 15:38367222-38367244 TTACATTCTAGATGAGGGAGAGG + Intergenic
1126068996 15:44849400-44849422 TGACTGTCTAGGTGTGAGAGGGG + Intergenic
1126089822 15:45041373-45041395 TGACTGTCTAGGTGTGAGAGGGG - Intronic
1128485838 15:68087139-68087161 TGATTATTTAAATGAGTGAATGG + Intronic
1129260103 15:74361139-74361161 TGGCTTTCTAGATGAATCAGAGG + Intronic
1129288343 15:74543709-74543731 TGAGTTTTAAGATGAGTGAGTGG - Intronic
1131200398 15:90390672-90390694 TGACTTTCTAGGTGAGTGGCAGG + Intronic
1131537568 15:93250333-93250355 TGACTATATAAATGAGTTCGTGG + Intergenic
1143262836 17:5612985-5613007 TAAGTATCTATGTGAGTGAGTGG + Intronic
1146996931 17:37329243-37329265 TAACTATCTTGATGATTGATAGG - Intronic
1150310368 17:64123809-64123831 TCAATATCTAAATGATTGAGTGG + Intronic
1156400517 18:36735370-36735392 AGAATATCTTGATGACTGAGTGG + Intronic
1162155538 19:8675813-8675835 TGAATATATAGATGAATGAATGG + Intergenic
1163350715 19:16774958-16774980 TGGCTAGTTGGATGAGTGAGTGG - Intronic
1166582175 19:43910907-43910929 TGAATATATAGATGAGTTTGGGG - Intergenic
1168443382 19:56391160-56391182 TGATCATCTAGGTGGGTGAGTGG - Intronic
925032906 2:665277-665299 TGATTCTCTATCTGAGTGAGTGG - Intergenic
925032912 2:665336-665358 TGATTCTCTATCTGAGTGAGTGG - Intergenic
925032927 2:665450-665472 TGATTCTCTATCTGAGTGAGTGG - Intergenic
925032956 2:665678-665700 TGATTCTCTATCTGAGTGAGTGG - Intergenic
925782998 2:7400423-7400445 TAAGTATCTAGATAATTGAGTGG - Intergenic
926131956 2:10308750-10308772 TGAGTATCTAGCAGAGTGTGGGG + Intronic
930187288 2:48422546-48422568 TCACTATCTTGATGAGGGTGTGG - Intergenic
932300986 2:70666925-70666947 TGACTCTATAGTTGAGGGAGTGG - Intronic
935057338 2:99579001-99579023 TGACTGTTGAGATGAGTGAATGG - Intronic
938188641 2:129255157-129255179 TGGGTATCTAGATGGGTGAGTGG - Intergenic
938188673 2:129255297-129255319 TGGGTATCTAGATGGGTGAGTGG - Intergenic
947582087 2:231326601-231326623 TGACTATGTGGTTGAGAGAGTGG + Intronic
1172173559 20:32959270-32959292 GGACAATCTACATGATTGAGTGG + Intronic
1174289242 20:49496012-49496034 TGAGTATATAGATGGATGAGGGG - Intergenic
1175601863 20:60280924-60280946 TGGCTAGCTACATGGGTGAGTGG + Intergenic
1176184345 20:63770054-63770076 TGACTCTTTAAAAGAGTGAGGGG + Intronic
1179635196 21:42704277-42704299 TGACTATGGAGATGTGGGAGGGG - Intronic
1182099716 22:27649342-27649364 TGAATAGATGGATGAGTGAGAGG + Intergenic
1183099982 22:35578097-35578119 TGGCTGGCTGGATGAGTGAGAGG + Intergenic
1183731369 22:39620327-39620349 TGACTATACAGATGAATGAATGG - Intronic
950731785 3:14966065-14966087 TGATTAGCTAAATGAGTAAGAGG + Intronic
952698938 3:36304433-36304455 TGACTATTTAGATGAGACAAGGG + Intergenic
953826153 3:46252659-46252681 TGAATATCTAGATGGGTAATTGG + Intronic
954208221 3:49076380-49076402 TGACTTGCGTGATGAGTGAGGGG - Intronic
961397416 3:126605335-126605357 TGACTTACTAGATGTGTGATAGG - Intronic
965015977 3:163156955-163156977 AGACAATCATGATGAGTGAGGGG - Intergenic
965508203 3:169539534-169539556 TGACTGTGGAGATGAGTGGGTGG - Intronic
966520155 3:180865771-180865793 TGACTCTGTAGATCAGTTAGGGG - Intronic
967312414 3:188118366-188118388 GGCCTTTCTAGATGAGTGACTGG - Intergenic
967604530 3:191429971-191429993 TGACTATCAAGATAAGTGTAAGG + Intergenic
970592507 4:17571754-17571776 TGGCTCCCTAGATGAGTGGGGGG + Intergenic
972822804 4:42721579-42721601 AGATTATCTAGATTATTGAGAGG - Intergenic
973651103 4:52997728-52997750 TGACTGTCTAGGTTGGTGAGGGG - Intronic
976118425 4:81753677-81753699 TTTCTATCTAGAGGAGTGTGTGG + Intronic
976618747 4:87106046-87106068 TGATGATGTAGATGAGTGTGGGG - Intronic
977251249 4:94691993-94692015 TGACAATCTAAATAAATGAGGGG + Intergenic
979086700 4:116420945-116420967 TCACTATTTTGAAGAGTGAGTGG - Intergenic
981646705 4:147006638-147006660 TGACTGTGAAGATGGGTGAGAGG - Intergenic
982665543 4:158257480-158257502 TGACTTTCAAGATGAGGGAAGGG + Intergenic
989466676 5:41764706-41764728 TAAATATTTGGATGAGTGAGTGG + Intronic
990963411 5:61418594-61418616 TGACTATCTAGATGAGTGAGGGG + Intronic
993435546 5:87888593-87888615 TAATTATCTAGTAGAGTGAGTGG + Intergenic
994030557 5:95136977-95136999 AGGCTGTCTAGATGAGTGGGTGG - Intronic
997499152 5:134357792-134357814 TGACAATCTAGATGTGTGGGTGG - Intronic
999066010 5:148686300-148686322 AGACTATGTAGAGGAGTGAATGG - Intergenic
1000093424 5:157949870-157949892 TGAATATATAAATGAGAGAGTGG - Intergenic
1000425203 5:161082134-161082156 AGAATTTCTAGATGAGGGAGGGG - Intergenic
1001089037 5:168723380-168723402 TGACCATTTGGATGAATGAGTGG - Intronic
1001782316 5:174380521-174380543 TGACTGTATAGACGAGTGAGTGG - Intergenic
1003359395 6:5409999-5410021 TGATGAACTAGAAGAGTGAGAGG + Intronic
1003972556 6:11313174-11313196 TGAATATCTAGATGGGTGGATGG + Intronic
1010637022 6:78272618-78272640 TGACATTGTAGTTGAGTGAGAGG - Intergenic
1011424581 6:87212832-87212854 TGACCAGCTAGATGATTCAGAGG - Intronic
1011694003 6:89895660-89895682 TGACTATGAAGATCTGTGAGAGG - Exonic
1013188801 6:107784677-107784699 AGTCAATCTAAATGAGTGAGTGG + Intronic
1015872596 6:137792349-137792371 TCTCTATCTAGATCAGAGAGGGG - Intergenic
1016130936 6:140469565-140469587 TAACTATCTTAATGAGTGACAGG + Intergenic
1026026445 7:66748315-66748337 AGATTATCTAGATGAGTAGGTGG + Intronic
1027605668 7:80295504-80295526 TGACCATCTAAAGGAGTGTGTGG + Intergenic
1029604829 7:101592267-101592289 TGGATACCTAGATGGGTGAGGGG - Intergenic
1030732222 7:113003735-113003757 TTACAGTCTAGAAGAGTGAGAGG - Intergenic
1031455849 7:121978762-121978784 TAAGTATCCAGATGAATGAGTGG - Intronic
1034525613 7:151659015-151659037 TGACTTTCTTGAGAAGTGAGGGG + Intronic
1035824868 8:2633728-2633750 TGACCATGTGGATCAGTGAGAGG + Intergenic
1048655493 8:136530967-136530989 TGGCAATCTATATGAGTGAGAGG - Intergenic
1049445695 8:142630350-142630372 TGAATTTCTAGATGGGAGAGTGG - Intergenic
1051785030 9:20732819-20732841 TGAATATGTAGATGACTGAAAGG + Intronic
1055418068 9:76105902-76105924 TGCCTATCTAGATCCATGAGAGG + Intronic
1055588010 9:77776813-77776835 TGACTATGTAGATCAGTTTGGGG - Intronic
1060513259 9:124249379-124249401 TGGCTTTGGAGATGAGTGAGGGG - Intergenic
1061050044 9:128189950-128189972 TGACCATCCAGATGTCTGAGTGG - Intronic
1061301582 9:129708802-129708824 TGACTATGTAAATGAAGGAGCGG - Intronic
1185883200 X:3758891-3758913 TGGCTGGCTAGATGAGTGAGTGG - Intergenic
1186219530 X:7334619-7334641 TGGCTTGCTAGAAGAGTGAGGGG - Intronic
1187118703 X:16381987-16382009 TGACTATCTTAATGGGTGTGAGG - Intergenic
1188547022 X:31319091-31319113 TTACTTTCTTCATGAGTGAGTGG + Intronic
1194073694 X:89361187-89361209 TCAGTATCTACATGAGTTAGAGG + Intergenic
1195422810 X:104694530-104694552 TGACTATCTAGAAATGAGAGGGG + Intronic
1196632299 X:117955910-117955932 TGAATATGTAGATAGGTGAGTGG - Intronic
1199111619 X:143941779-143941801 TGTATATTTTGATGAGTGAGAGG + Intergenic
1200373719 X:155756947-155756969 CAACTGTCTAGATGAGAGAGTGG - Intergenic