ID: 990966240

View in Genome Browser
Species Human (GRCh38)
Location 5:61451031-61451053
Sequence TAGCCAGATGGTCAGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990966240 Original CRISPR TAGCCAGATGGTCAGTCTTC AGG (reversed) Intronic
902321165 1:15667479-15667501 AGCCCAGATGGTCAGTATTCCGG - Exonic
902612062 1:17603239-17603261 TAGCCAGATGGGCAGGCCTGCGG + Intronic
902656754 1:17874362-17874384 AAGCCAGATGGTCATCTTTCAGG + Intergenic
904333862 1:29784660-29784682 CCGACAGATGGTCAGTGTTCTGG - Intergenic
906795512 1:48693601-48693623 TTGCCAGATGGGCACTCTGCTGG + Intronic
911056806 1:93715739-93715761 TAGACAGATGGTGGCTCTTCAGG + Intronic
912039794 1:105375292-105375314 TAGAAAGATAGTCTGTCTTCTGG + Intergenic
912084832 1:105986465-105986487 TAGCCCCATGTTCAGTTTTCTGG + Intergenic
914447760 1:147764291-147764313 GTACCAGATGCTCAGTCTTCTGG - Intronic
917239713 1:172934389-172934411 CATCCAGATGGCCAGTCATCTGG + Intergenic
920767038 1:208843298-208843320 TAGCCACATGGCAGGTCTTCAGG - Intergenic
1063889892 10:10618393-10618415 TTGCCAGATCCTCAGACTTCTGG + Intergenic
1064973290 10:21088148-21088170 TCTCCACATTGTCAGTCTTCTGG + Intronic
1067177855 10:43962688-43962710 TAGCCAGCAGGTCACTCTTAAGG - Intergenic
1070054081 10:72917671-72917693 TAGCCTCTTGGTCAGTCATCCGG + Intronic
1073155080 10:101339926-101339948 AAACCAGAGGGTCAGTCTCCGGG + Intergenic
1075215132 10:120526007-120526029 TAGGCAGATGTTGAGTCTCCTGG + Intronic
1079350445 11:19687303-19687325 TATCCAGATAGTCAATCTCCAGG + Intronic
1085243635 11:75079292-75079314 TAGCCTCCTGGTCAGTCATCTGG + Intergenic
1085744884 11:79106403-79106425 CAGCCAGCTGGTCACTCTGCTGG - Intronic
1086669635 11:89531317-89531339 TAGAAAGAGGTTCAGTCTTCAGG - Intergenic
1097582013 12:61469737-61469759 AAGACAGATGTGCAGTCTTCAGG - Intergenic
1097601280 12:61695563-61695585 TTGCCAGCATGTCAGTCTTCTGG - Intergenic
1099178461 12:79451011-79451033 TGGCCTCATGTTCAGTCTTCAGG + Exonic
1099368273 12:81797172-81797194 TAGGCAACTGGTAAGTCTTCAGG - Intergenic
1100202357 12:92312812-92312834 TAACCAGATGGTCTCTGTTCTGG - Intergenic
1103033239 12:117634846-117634868 TGGCCAGAGGGTCTGCCTTCTGG - Intronic
1106298519 13:28440418-28440440 TAGCCAGAGGTTCAGCCTTCAGG - Intronic
1112423335 13:99273823-99273845 TACCTAGATGTTCAGTCTCCTGG + Intronic
1118437414 14:65784365-65784387 CAGCCAAATGGTCTGTCTTTGGG + Intergenic
1119555778 14:75551294-75551316 AAGCCAGATCTTCAGTCCTCAGG + Intergenic
1121277055 14:92675738-92675760 TTGCCAAATGGGCAATCTTCAGG + Intronic
1129299665 15:74618365-74618387 TAGCCAGAGGGTTAGCCATCTGG - Intronic
1129619726 15:77133098-77133120 TGGACAGCTGGTCAGACTTCAGG - Exonic
1131532488 15:93205649-93205671 GAGCCAGGTGGTGTGTCTTCAGG + Intergenic
1134382434 16:13740364-13740386 CAGGCAGATGGTTAGGCTTCTGG - Intergenic
1146725531 17:35152663-35152685 TAACCAGATGGTGAGCCTTCAGG + Intronic
1149400547 17:56291582-56291604 TAGGCAGCTGGCCAGTGTTCAGG - Intronic
1155472527 18:26205851-26205873 TAGCCTCCTGGTCAGTCTTCCGG - Intergenic
1157267752 18:46243274-46243296 TAGTCAGATGGTCATTCTTATGG + Intronic
1157993244 18:52522760-52522782 TATCCAGAGGATCAGTCTTCTGG + Intronic
1158617434 18:59001224-59001246 TGCCCAGGTGGTCAGACTTCAGG + Intergenic
1159987530 18:74861183-74861205 AAGACAGACTGTCAGTCTTCAGG + Intronic
1162345351 19:10115253-10115275 GAGCCAGATGGCCAGTCTCCAGG + Exonic
1162513042 19:11131280-11131302 GAGACAGATGGTCAGTCTGGAGG + Exonic
1164593753 19:29520324-29520346 TAGATAAATGATCAGTCTTCGGG + Intergenic
1164596160 19:29531665-29531687 TAGCCTGAGGGACAGTCTTGTGG - Intronic
1165853975 19:38869228-38869250 CAGCCAGATGGGCAGTCACCTGG + Exonic
926840491 2:17074339-17074361 TGGCCAGATGCTCTGACTTCTGG - Intergenic
932445533 2:71778716-71778738 TAGCCACATGGCAAGTCTTGTGG - Intergenic
935172758 2:100623486-100623508 TAGCCACATGGCCATGCTTCAGG + Intergenic
940430676 2:153586758-153586780 CAGACATATGGTCAGTCTTAAGG - Intergenic
940507335 2:154572989-154573011 TAGCCAGATTATCAGTTTTTGGG + Intergenic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1168836182 20:878996-879018 TAGCCTGATGGTTAATATTCAGG + Intronic
1168947531 20:1773949-1773971 TAGCCAGGTAGTCAGGCTCCAGG + Intergenic
1175816350 20:61884972-61884994 TAGCCTAAGGGTCAGTCTGCAGG + Intronic
1176418789 21:6498153-6498175 AAGCCAGATGCTGAGTCTTTAGG + Intergenic
1177414501 21:20776690-20776712 TTGCCAGCAGGTCAGGCTTCTGG + Intergenic
1177522894 21:22253059-22253081 GAGCCAGAAGGTGAGTCTTTTGG - Intergenic
1177783123 21:25640480-25640502 TAGCCAGCTGCTCTGTCCTCAGG + Intronic
1179694283 21:43106475-43106497 AAGCCAGATGCTGAGTCTTTAGG + Intronic
1183590642 22:38777476-38777498 CAACCAGATGGTCAGCCTTGAGG + Intronic
951923313 3:27879428-27879450 TACTTAGATGGTTAGTCTTCTGG + Intergenic
955943972 3:64173542-64173564 GAGCCAATTGGTCAGTTTTCAGG - Intronic
960400302 3:117189229-117189251 TAGCCACATGGTAAATGTTCTGG + Intergenic
961647914 3:128402219-128402241 CAGCCAAATGGACAGTCTTCCGG + Intronic
962709242 3:138071642-138071664 CAGCCAGACGGGCAGCCTTCAGG - Exonic
966938853 3:184732498-184732520 TCGCCTGATGGGCAGTCTTCTGG + Intergenic
967175268 3:186857084-186857106 TAGCCAGATGGTGTGGCTTGGGG - Exonic
968381504 4:100631-100653 TTGCCAGCATGTCAGTCTTCTGG - Intergenic
973781269 4:54290339-54290361 CAGCAGGATGGTCACTCTTCAGG - Exonic
974734198 4:65908231-65908253 TTGACAGATGGTCATTGTTCAGG - Intergenic
975756635 4:77578068-77578090 TTGCCAGGATGTCAGTCTTCTGG - Intronic
982477627 4:155872705-155872727 TAGCCAGCATGTCAGGCTTCTGG + Intronic
985985197 5:3509895-3509917 TGGCCAGCTGGACAGTCTTAAGG - Intergenic
987306734 5:16644403-16644425 TACACAGCTGGTTAGTCTTCAGG - Intergenic
990966240 5:61451031-61451053 TAGCCAGATGGTCAGTCTTCAGG - Intronic
992891404 5:81207717-81207739 TGGTCAGATGGGCTGTCTTCAGG - Intronic
994828218 5:104744022-104744044 TAACCATATGGTAGGTCTTCAGG - Intergenic
995337068 5:111011681-111011703 GAGCCAGCGGGACAGTCTTCTGG + Intergenic
995932142 5:117458813-117458835 TGGCCAGATTGTCATTCTTTTGG - Intergenic
998911269 5:146962926-146962948 TAGCCAGTTGCTCAGTCCACTGG - Intronic
999060162 5:148625138-148625160 TAGAAAGATGGCCAGTCGTCTGG + Intronic
1003281998 6:4702132-4702154 TAGCGAGAGGGACAGTCTCCAGG - Intergenic
1004398487 6:15267394-15267416 TAACCAGTTGGTTAGGCTTCAGG - Intronic
1004672801 6:17813795-17813817 TACCCAGATGGTCAGTTAGCTGG - Intronic
1006285854 6:33093339-33093361 TAGACGGATGTTAAGTCTTCAGG - Intergenic
1009892554 6:69705322-69705344 TAGCCTCCTGGTCAGTCATCCGG + Intronic
1018646860 6:165957047-165957069 TAGCCAGGAGGTCATTTTTCTGG - Intronic
1020774852 7:12440692-12440714 TAGCCAGAAGGACATTTTTCTGG + Intergenic
1023718797 7:43072139-43072161 TTGCCAGCATGTCAGTCTTCTGG + Intergenic
1025738160 7:64173298-64173320 TAGTCAGAGGGAGAGTCTTCTGG + Intronic
1028975879 7:96913501-96913523 TAAACAGATGGTCAGCCATCAGG - Intergenic
1034207998 7:149334803-149334825 TAGCCTCCTGGTCAGTCATCTGG - Intergenic
1035456003 7:159009202-159009224 CAGCCTGGTGGTCAGTCTCCTGG + Intergenic
1035875549 8:3185104-3185126 TAGCCAGTTGGTCAGAGTGCAGG + Intronic
1037938790 8:22933910-22933932 TTACCAGATGCCCAGTCTTCCGG - Intronic
1039877462 8:41599163-41599185 TAGCCTGATTGTCAACCTTCTGG + Exonic
1041711238 8:60896428-60896450 CAGCCACATGGTCTGTCTTCTGG + Intergenic
1041745397 8:61203170-61203192 TAGCCTCTTGGTCAGTCATCCGG - Intronic
1051368410 9:16337688-16337710 TAGCCATATCGTAAGCCTTCAGG - Intergenic
1055563140 9:77542388-77542410 ATGCCAGATGGCCAGTCTGCAGG + Intronic
1056100289 9:83294251-83294273 TTGCCAGATGCTCAATCTGCTGG + Intronic
1056694326 9:88833451-88833473 TGGACAGTTGGTCAGTCCTCAGG + Intergenic
1059567055 9:115393464-115393486 TTTCCAGAAGGTCAGTCCTCAGG + Intronic
1059764897 9:117374854-117374876 TGTCCAGATAGTCAGGCTTCTGG - Intronic
1187356956 X:18584619-18584641 TAGTCAGCTGGTAGGTCTTCTGG + Intronic
1190364921 X:49683302-49683324 TAGCTAGATGGCAAGTCATCAGG + Intergenic
1190755351 X:53396542-53396564 TGGCCAGATGCTGATTCTTCAGG + Exonic
1193952639 X:87820082-87820104 TAGCCACATGGGCATTCTACTGG + Intergenic
1194798569 X:98242011-98242033 TAGCAAAATGGTTAGTCTACTGG - Intergenic
1196967720 X:121076713-121076735 TTGCCAGAGAGTCAGGCTTCTGG - Intergenic
1197257676 X:124281368-124281390 TAGCCTCCTGGTCAGTCATCTGG - Intronic
1197726371 X:129779634-129779656 CAGCCAGATGGTCCAACTTCTGG + Intergenic
1198203309 X:134443297-134443319 GGGCCAGAGAGTCAGTCTTCTGG - Intergenic
1202270362 Y:23066290-23066312 TGGCCAGCATGTCAGTCTTCTGG + Intergenic
1202295665 Y:23354392-23354414 TGGCCAGCATGTCAGTCTTCTGG - Intergenic
1202423356 Y:24700035-24700057 TGGCCAGCATGTCAGTCTTCTGG + Intergenic
1202447433 Y:24970051-24970073 TGGCCAGCATGTCAGTCTTCTGG - Intergenic