ID: 990968425

View in Genome Browser
Species Human (GRCh38)
Location 5:61475773-61475795
Sequence TTAATGACTTAATAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990968421_990968425 0 Left 990968421 5:61475750-61475772 CCTGGAGGGTCTTATTTTAATTG 0: 1
1: 0
2: 1
3: 17
4: 309
Right 990968425 5:61475773-61475795 TTAATGACTTAATAGGTGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 185
990968420_990968425 1 Left 990968420 5:61475749-61475771 CCCTGGAGGGTCTTATTTTAATT 0: 1
1: 0
2: 1
3: 33
4: 278
Right 990968425 5:61475773-61475795 TTAATGACTTAATAGGTGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 185
990968416_990968425 29 Left 990968416 5:61475721-61475743 CCTTAAGTGATGAAATGGGAAAT 0: 1
1: 0
2: 2
3: 18
4: 277
Right 990968425 5:61475773-61475795 TTAATGACTTAATAGGTGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990968425 Original CRISPR TTAATGACTTAATAGGTGGT GGG Intronic
902111576 1:14083095-14083117 TTAATGTCTGAAGAGGTGGCAGG - Intergenic
902649002 1:17824245-17824267 TTATTTACAAAATAGGTGGTGGG - Intronic
903088600 1:20887913-20887935 TTAATAACTTACTAAATGGTTGG + Intronic
903101029 1:21029753-21029775 TTAAAGAATTAAAAGGTTGTAGG + Intronic
907839049 1:58138925-58138947 TGAATGAGTGAATAGGTGGGTGG + Intronic
908363926 1:63398045-63398067 TTATTGACTTACTAGATGGTTGG + Intronic
909489138 1:76207209-76207231 TTAATGACTTGCTAGCTGGCTGG - Intronic
913292544 1:117287442-117287464 TTAGGGATTTAATAGTTGGTAGG - Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
918276406 1:182957397-182957419 TTAAAGACTTAATAAGGGCTGGG + Intergenic
919992173 1:202715744-202715766 TTATTGACTGGATAGGTGATGGG - Intergenic
920603906 1:207361074-207361096 TGAATGAATGAATAGGTGGATGG - Intergenic
921699121 1:218247051-218247073 TAAATGAATGAATAGGTGATTGG + Intergenic
1064533536 10:16334389-16334411 TTAATGAGCTAACAGGGGGTTGG - Intergenic
1065609774 10:27461618-27461640 TTAATGACATTAAAGGAGGTTGG - Intergenic
1066358455 10:34707462-34707484 TAAATGTATAAATAGGTGGTTGG - Intronic
1066584993 10:36923080-36923102 TAAATTATTTAAAAGGTGGTGGG - Intergenic
1066668720 10:37814294-37814316 TCAATAACTTAAAAAGTGGTGGG - Intronic
1070232338 10:74582090-74582112 TTAATGAGATAATACGTGGTTGG - Intronic
1073727183 10:106247007-106247029 TTAAATACTTAATAATTGGTAGG - Intergenic
1076278237 10:129224073-129224095 TTAATGGCTGAGTAGGTGGGTGG + Intergenic
1078297426 11:10087941-10087963 TTATGTACTTAATATGTGGTAGG + Intronic
1078497869 11:11838526-11838548 TTAATGACCTACTATGTGCTAGG + Intergenic
1081160414 11:39742047-39742069 TTAATAACTTAATTGTTGGCTGG + Intergenic
1084996958 11:72990129-72990151 TTAAGCACTTAATAAGTGTTAGG + Intronic
1085835110 11:79947178-79947200 TTCATGTCTTGATAGGTGTTTGG + Intergenic
1086258036 11:84903349-84903371 TTAAAGAATTAGTAGGAGGTAGG - Intronic
1087876338 11:103362731-103362753 TAAATGATATAATAGGTGGCTGG + Intronic
1087943230 11:104126530-104126552 TTGATGACTTACTATGTGCTAGG + Intronic
1088400111 11:109414364-109414386 TTTATGATTTAAAAGGTTGTAGG + Intergenic
1088497939 11:110450879-110450901 TTAGTGTCTTTATAAGTGGTTGG - Intronic
1089910735 11:122097819-122097841 TGAATAACATAATTGGTGGTTGG - Intergenic
1093131259 12:15394026-15394048 TTAATGAATTAATAGATCATTGG - Intronic
1094463116 12:30719620-30719642 TTAAAGACTTATTAGTTAGTAGG + Intronic
1094729059 12:33153720-33153742 TTAAGGACTTTAAAGGTGGGGGG - Intergenic
1095347052 12:41162781-41162803 TTAGTGACAAAATAGGTGGCAGG + Intergenic
1095474851 12:42575826-42575848 TTAATGACTAAATAGGAGTTTGG - Intronic
1096813642 12:54187769-54187791 AAAATGAGTTAACAGGTGGTAGG - Intronic
1098698053 12:73584291-73584313 TTCATAACTTAAAAGGTGTTAGG - Intergenic
1100752588 12:97715573-97715595 TAAATGAATGAATAGGTGTTGGG + Intergenic
1102021114 12:109683617-109683639 TAAATGAGTTGATAGGTGGATGG + Intergenic
1102524944 12:113505791-113505813 TTGATGAGTTAATAGATTGTTGG + Intergenic
1103255995 12:119541906-119541928 TAAATGACTGAATAGGTGAATGG - Intergenic
1108382792 13:49870227-49870249 TTAATTATTTAATTTGTGGTGGG + Intergenic
1109015261 13:57002173-57002195 TTAAACAATTAATAGATGGTAGG - Intergenic
1109304338 13:60622065-60622087 TTAATTTCTGGATAGGTGGTTGG - Intergenic
1110305004 13:73976073-73976095 TTAATGACTTATTATGTGCCAGG - Intronic
1110343424 13:74418700-74418722 TTAATGAATTAATAGGGGAAAGG - Intergenic
1113518450 13:110920896-110920918 TTAAGGACTTAATATGGGCTGGG - Intergenic
1113912692 13:113851486-113851508 TGAATGAATGAATAGGTGGGTGG + Intronic
1118609668 14:67530345-67530367 TTTATCACTTAAGTGGTGGTGGG - Intronic
1119842286 14:77802242-77802264 TTAATGAGCTAATAAGTGCTTGG + Intronic
1120700584 14:87694590-87694612 GTACTGACTTAAAAGGTGTTGGG - Intergenic
1122619355 14:103045884-103045906 TTAAGGACTTAAGATGTGCTAGG - Intronic
1123490816 15:20780826-20780848 TTAAGGACATAAGAGGAGGTGGG - Intergenic
1123547318 15:21349917-21349939 TTAAGGACATAAGAGGAGGTGGG - Intergenic
1123915404 15:25020297-25020319 TCAAAGAATAAATAGGTGGTTGG + Intergenic
1125458137 15:39881382-39881404 TTAGTGACATAGTAGGTAGTAGG - Intronic
1126471666 15:49018616-49018638 TGAATGAGTTAATAGATGGGAGG - Intronic
1128869163 15:71139314-71139336 TTATTTACTCAATAGGTGGTAGG - Intronic
1130026179 15:80272435-80272457 TTCATTACTTCATAGGAGGTGGG + Intergenic
1131105809 15:89733561-89733583 TTAATGGATTAATAGGTGAATGG + Intronic
1202955649 15_KI270727v1_random:77148-77170 TTAAGGACATAAGAGGAGGTGGG - Intergenic
1134174475 16:11994653-11994675 TTAATGACTTAGCCTGTGGTTGG + Intronic
1134187243 16:12094312-12094334 TTAAAGACTGAATAACTGGTAGG + Intronic
1134450305 16:14359299-14359321 TAAATGAATTAATAGATGGATGG + Intergenic
1135638834 16:24102257-24102279 TTGATGACATAATAGTTGGAAGG + Intronic
1141338136 16:83176688-83176710 TTACTGTCTTAAAAGGGGGTTGG + Intronic
1146297462 17:31661067-31661089 TTAGTAACTTAGTAGGTGCTAGG + Intergenic
1146677809 17:34785536-34785558 TTATGGACAAAATAGGTGGTGGG + Intergenic
1149245003 17:54695483-54695505 TTAATGAATGAACAGCTGGTAGG - Intergenic
1153875487 18:9366698-9366720 TTAAGGAATAAATAGGTGCTAGG + Intronic
1157469786 18:47980097-47980119 TTAATGACCTACAAAGTGGTGGG + Intergenic
1157665635 18:49484591-49484613 ATAAAGAAATAATAGGTGGTAGG + Intronic
1158650110 18:59276473-59276495 TTAATGAATTAATCAGAGGTGGG - Intronic
1159389789 18:67775781-67775803 TTAATGAAATAACAGGTGGCAGG + Intergenic
1160177047 18:76603457-76603479 TTGAGGACTTCAAAGGTGGTGGG + Intergenic
1162521148 19:11180243-11180265 TTAATGGCTAAAAAGGTTGTTGG + Intronic
1163158330 19:15450676-15450698 TGGGTGAATTAATAGGTGGTTGG - Intergenic
1166897008 19:46029690-46029712 TTAATGAGTTAATAGATGAATGG + Intergenic
1167442722 19:49518199-49518221 TTAAAGAGTTAATTGGTTGTAGG - Intronic
926503770 2:13685510-13685532 CTCATCTCTTAATAGGTGGTGGG - Intergenic
927023595 2:19042804-19042826 TCAATGACACAATAGGTTGTTGG - Intergenic
930312752 2:49762456-49762478 TTATTTACTTAATAAATGGTAGG - Intergenic
930375630 2:50562762-50562784 GTAATAATTTAATATGTGGTAGG - Intronic
931949067 2:67341020-67341042 TTAAGCACTTAATATGTGGCAGG + Intergenic
933365258 2:81345635-81345657 TTTATGACTAATTAGGAGGTGGG - Intergenic
941482175 2:166029664-166029686 TGAATGAATAAATAGGTGATGGG - Intronic
942004346 2:171682633-171682655 TTAACCACATAATAGGGGGTAGG + Intergenic
942692008 2:178595689-178595711 TCAATGACATAATTGGTGATTGG + Exonic
943033637 2:182714857-182714879 TAAATGCTTTAAGAGGTGGTGGG - Intergenic
943670236 2:190652361-190652383 TGAATGACTTGATGGTTGGTTGG + Intronic
944753772 2:202738823-202738845 TTAAGCACTTAATATGTGCTAGG - Intronic
946266357 2:218545484-218545506 TAAAAGTCTGAATAGGTGGTAGG - Intronic
947076500 2:226351000-226351022 TTAATGGCTTACCTGGTGGTGGG + Intergenic
948303574 2:236929102-236929124 TTAATTAATTAAATGGTGGTTGG + Intergenic
1170073473 20:12393742-12393764 TTAATTATTTAATAGGTTCTAGG - Intergenic
1170691271 20:18617566-18617588 TTAATGATTGAATAGGTAGTAGG + Intronic
1174515371 20:51087994-51088016 CTGATGACTTAAAAGGTGTTCGG - Intergenic
1175676485 20:60950440-60950462 TGAGTGAATTAATAGGTGGAGGG + Intergenic
1176447805 21:6834999-6835021 TTAATGACATAAGAGGAGGTGGG + Intergenic
1176825975 21:13700025-13700047 TTAATGACATAAGAGGAGGTGGG + Intergenic
1177389728 21:20452007-20452029 TGATTGACTTAATATGTGTTTGG + Intergenic
1179549187 21:42132616-42132638 TTAATGAATAAATGGGTGGATGG - Intronic
1181870430 22:25893967-25893989 TTAATGGATAAATAGTTGGTTGG - Intronic
1182023768 22:27101533-27101555 TAAATAAGTTAACAGGTGGTTGG - Intergenic
950095259 3:10325321-10325343 CTAATGTCTTATTATGTGGTGGG - Exonic
955841364 3:63116474-63116496 GTAATGACTGGATAGGAGGTAGG + Intergenic
955975112 3:64472580-64472602 ATAATAACTTAATATGTGGTTGG - Intergenic
956267658 3:67415382-67415404 TTAATCACTTACTAGATGCTAGG + Intronic
956829062 3:73027921-73027943 TTTATGAGTGAATAGGTAGTTGG + Intronic
959038034 3:101387703-101387725 GTAATGACTTAAGCGGTGGCTGG - Intronic
959349650 3:105245804-105245826 TTAATGGCTAAATATGTTGTTGG + Intergenic
963633868 3:147768603-147768625 TTAATAACTTAAAAGAAGGTTGG - Intergenic
964074854 3:152681380-152681402 TTAAAGACTGAATAGGAGTTGGG - Intergenic
967069556 3:185950613-185950635 TTTAAGACTTAATAGAAGGTCGG - Intergenic
968924862 4:3541826-3541848 TGAATGAATTGATAGGTGGGTGG + Intergenic
969352503 4:6605903-6605925 TGAATGAATGAATGGGTGGTTGG - Intronic
969410747 4:7026453-7026475 TAAATGGCTTTATAGTTGGTTGG + Intronic
971105341 4:23518131-23518153 TTGATGAATTAATGGTTGGTAGG - Intergenic
971580439 4:28331874-28331896 TTAATAACTTAATTGCAGGTTGG - Intergenic
971922675 4:32962678-32962700 TTAATAACTTAGTAGGAGATTGG - Intergenic
972502421 4:39691030-39691052 TTAATAACTTATTAGGGGCTGGG - Intergenic
975029503 4:69597689-69597711 TTAATGAATTAATATCTGTTTGG - Intronic
976467987 4:85393196-85393218 TTAATAACTTTATACGTGGCAGG - Intergenic
980434196 4:132747830-132747852 TTAATGAGTTAATAAGTGAATGG - Intergenic
982391082 4:154864345-154864367 TAAATGACTTAATACATGGAAGG + Intergenic
985581894 5:702395-702417 TTAGTGACTTATTAAGTGGTTGG + Intergenic
985596506 5:793686-793708 TTAGTGACTTATTAAGTGGTTGG + Intergenic
987389023 5:17358099-17358121 TCAATGAATTAATTGGTGTTGGG + Intergenic
989484997 5:41979414-41979436 TTAATAACATAATCAGTGGTAGG - Intergenic
989989574 5:50745419-50745441 TTAATGGCTTAACAGGTGCAAGG - Intronic
990081441 5:51919969-51919991 TTTATTACTTAAGTGGTGGTTGG - Intergenic
990968425 5:61475773-61475795 TTAATGACTTAATAGGTGGTGGG + Intronic
991534848 5:67658063-67658085 TTAATGACTTTATGGTTGGTGGG - Intergenic
993805622 5:92405161-92405183 CTAATGACTTAATATTTGCTTGG - Intergenic
995448651 5:112275744-112275766 TTAATGAAATGATAGGTGGGTGG - Intronic
995765209 5:115607648-115607670 TTTATGACATAATAAGTGGCTGG - Intronic
995836833 5:116407728-116407750 TCACTCACTTAGTAGGTGGTAGG - Intronic
996577316 5:124989988-124990010 TTAATAAAGTAATAGATGGTGGG + Intergenic
996651601 5:125884098-125884120 TACATGATTTAATAGGTGTTGGG + Intergenic
997193018 5:131957428-131957450 TTAATGAGTAGATAGGTGGCTGG - Intronic
1000940988 5:167359535-167359557 GTAATATCTTAAAAGGTGGTAGG - Intronic
1002821415 6:728627-728649 TTAAGGAACTAACAGGTGGTGGG + Intergenic
1004059182 6:12175066-12175088 TTTATGACTAAATAGGGTGTGGG + Intergenic
1006337119 6:33426617-33426639 TAAATGACTAAAGAGGGGGTTGG - Intronic
1010510876 6:76717707-76717729 TTAATCATTTCATAAGTGGTAGG - Intergenic
1010918873 6:81655736-81655758 TCAATGGCTTAATAAGTTGTTGG - Intronic
1012561671 6:100588635-100588657 TTAATGAATTAACAGATGGAAGG - Intronic
1012633225 6:101499880-101499902 TTAATCAGTTAATGGGTGATAGG + Intronic
1013236824 6:108204194-108204216 CTAAACACTCAATAGGTGGTCGG + Intergenic
1020673015 7:11142863-11142885 TTAATGACTTAATGGTTAATTGG + Intronic
1021750305 7:23792701-23792723 TTTATGACTTAATAGATTCTAGG + Intronic
1021845921 7:24762563-24762585 TTAGTGACCTACTAGGTGCTGGG + Intergenic
1021926277 7:25537379-25537401 TTAATGAATTAATAGGTTAATGG - Intergenic
1023396456 7:39756168-39756190 TTAAAAACTTAATTGTTGGTGGG + Intergenic
1027527638 7:79290748-79290770 ATGATGACTTAATAGTTGTTTGG - Intronic
1028387990 7:90281094-90281116 TAAATGACTTAATACTTGGAAGG - Intronic
1029886771 7:103881132-103881154 TAGAGCACTTAATAGGTGGTAGG - Intronic
1031562656 7:123256593-123256615 TTAATGAATTAATGGGTTGATGG + Intergenic
1031659638 7:124405828-124405850 TTAATTAATGAATAGATGGTTGG - Intergenic
1031726711 7:125249044-125249066 TTTATTACATAGTAGGTGGTAGG + Intergenic
1032626443 7:133596616-133596638 TTAGTTACATCATAGGTGGTGGG + Intronic
1032874696 7:136025168-136025190 TCTATGACTTACTAGCTGGTTGG + Intergenic
1033812000 7:145025584-145025606 TTGATGTCTTAATAGGTAGCAGG - Intergenic
1040740938 8:50574671-50574693 TTAATGGATTAATAGATGTTTGG + Intronic
1041409261 8:57535509-57535531 TTGATGAAAAAATAGGTGGTGGG - Intergenic
1041567467 8:59296029-59296051 TTAATGACTTACTAGTTTATGGG - Intergenic
1042786698 8:72555277-72555299 ATAATCACTTAATATTTGGTAGG + Intronic
1043489378 8:80733105-80733127 TTAAAAACTTAATGGGTGGGTGG - Intronic
1043909482 8:85844602-85844624 TTAATGAATTAATGAGTGGGTGG + Intergenic
1048152528 8:131907998-131908020 TTAATGATTATGTAGGTGGTAGG + Intronic
1049736688 8:144211303-144211325 TTAATTAATTAATTGGTGGGAGG + Intronic
1050072742 9:1833576-1833598 TTAATGAATAAATAGGCTGTGGG + Intergenic
1050191353 9:3029805-3029827 TTAATTACTAAATAGGTGGCTGG - Intergenic
1050685354 9:8162460-8162482 TTAAGCACTTACTAGGTGATGGG - Intergenic
1052523004 9:29574156-29574178 TGAATGAATTAATAAGTGGAGGG - Intergenic
1052686260 9:31761148-31761170 GTATTGACTTAATAGTTGTTTGG + Intergenic
1053054947 9:34988628-34988650 CTAATGACTTAATGGGGGGTGGG + Intergenic
1053814604 9:41894512-41894534 TTTATAATATAATAGGTGGTTGG - Intronic
1054145277 9:61557132-61557154 TGAATGAATTGATAGGTGGGTGG - Intergenic
1054188339 9:61969847-61969869 TGAATGAATTGATAGGTGGGTGG + Intergenic
1054464960 9:65487989-65488011 TGAATGAATTGATAGGTGGGTGG - Intergenic
1054465035 9:65488285-65488307 TGAATGAATTGATAGGTGGGTGG - Intergenic
1054615992 9:67292929-67292951 TTTATAATATAATAGGTGGTTGG + Intergenic
1054650186 9:67618774-67618796 TGAATGAATTGATAGGTGGGTGG - Intergenic
1056172526 9:84000433-84000455 TTAGTCACTTAGTAGCTGGTTGG + Intronic
1057140075 9:92721128-92721150 TGAATGACTTAATACAAGGTTGG - Intronic
1059945290 9:119403318-119403340 TGAATTACATATTAGGTGGTAGG + Intergenic
1061348762 9:130047246-130047268 TTAATTACTTGGTTGGTGGTGGG + Intergenic
1203521385 Un_GL000213v1:49532-49554 TTAATGACATAAGAGGAGGTGGG - Intergenic
1187477498 X:19625223-19625245 TTAATGAATTAATGGGAGGGAGG + Intronic
1188863133 X:35282326-35282348 TTAATGACCTAAAAGGATGTAGG - Intergenic
1189126257 X:38450170-38450192 GTAATGACATAATTGGTGCTTGG - Intronic
1190112634 X:47604251-47604273 TTAATTAATTAATAGGAGGGAGG + Intronic
1190515709 X:51221805-51221827 TGAATGAATGGATAGGTGGTTGG - Intergenic
1192116267 X:68414459-68414481 TTAATAACTTAATTGGTGTTTGG - Intronic
1193667672 X:84342391-84342413 AAAATGTCTTAATAGCTGGTAGG - Intronic
1194923782 X:99798721-99798743 TTAATGAATTAATAAATGGTTGG + Intergenic
1195907668 X:109861789-109861811 TTAAGGACAGAATAGGTGGGTGG - Intergenic
1198007839 X:132516995-132517017 TTATTGAGTTATTATGTGGTAGG + Intergenic
1200375859 X:155779372-155779394 TTATTTACTTTAAAGGTGGTAGG - Exonic