ID: 990972302

View in Genome Browser
Species Human (GRCh38)
Location 5:61522008-61522030
Sequence TTGGTTGTCCCAAAACTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990972302 Original CRISPR TTGGTTGTCCCAAAACTTGG AGG (reversed) Intronic
905367994 1:37465947-37465969 TTGGTTGTGACAGAACTTGTGGG + Intergenic
905843482 1:41205735-41205757 GTGGTTCTCCCAACACTGGGAGG + Intronic
909576519 1:77182924-77182946 TTGGTTGCTCCTAAGCTTGGTGG + Intronic
909581212 1:77237312-77237334 TTGTTTATCCCAAAACATTGAGG + Intergenic
910841798 1:91568433-91568455 CTGGTGGTGCCAAAACTTGGCGG + Intergenic
921765179 1:218963695-218963717 TTGGTTCTGCCAAAAATTTGAGG - Intergenic
922739171 1:228006170-228006192 TTGGTGGTCCCAGAACCTGGGGG + Intergenic
924696620 1:246407086-246407108 TTGGTTTTCACAATAATTGGGGG + Intronic
1065946452 10:30609394-30609416 CTGGTTTTTCCCAAACTTGGAGG - Intergenic
1066517423 10:36178626-36178648 CTGTATATCCCAAAACTTGGTGG + Intergenic
1069547591 10:69339619-69339641 TTGGTTGTCCTGAAACGTTGGGG + Intronic
1070602571 10:77876136-77876158 CTGCTTGTTCCAAAACTTGGTGG - Intronic
1071954680 10:90744665-90744687 TTGGTTGTCACAAGTCTGGGTGG - Intronic
1072255023 10:93613084-93613106 CAGGTTGTCCTCAAACTTGGAGG - Exonic
1072450962 10:95539340-95539362 TTGGTTGTCACAAATCTTACTGG - Intronic
1073203516 10:101755315-101755337 TTCCCTGTCCCAAAACTTTGGGG - Intergenic
1073518567 10:104102377-104102399 TTGGTTTTCCCCAAACCAGGAGG + Intergenic
1078151281 11:8761557-8761579 TTGGTTGAACAAAAGCTTGGCGG - Intronic
1081722123 11:45297866-45297888 TTGACTGTCTCAAAACTTAGTGG - Intergenic
1082085150 11:48044023-48044045 TAGGATGTTCCAAAACTAGGTGG + Intronic
1082759215 11:57110194-57110216 TTAGTTGTCCCAATAGTTGGTGG + Intergenic
1092648635 12:10608134-10608156 TTTGTTGGTCCTAAACTTGGGGG - Intronic
1093327121 12:17789920-17789942 TTTGTTTTCCCAAAAGTAGGTGG + Intergenic
1096711796 12:53462941-53462963 ATGGTGGTCTCAAAATTTGGGGG + Intronic
1101577802 12:106014059-106014081 TTGGGTGTCCCAAAACATCCAGG + Intergenic
1103263935 12:119613113-119613135 TTGGTTGACCAAACAATTGGGGG - Intronic
1103402691 12:120654163-120654185 TAGGTGATCCCAAAACTTGAGGG - Intronic
1105956550 13:25288226-25288248 TTGGTTGTCTCAAATGGTGGTGG + Intergenic
1106209780 13:27631095-27631117 TAGATTATCCCAAAACTTAGTGG + Intronic
1106379753 13:29224823-29224845 TTGGAGGCCCCAGAACTTGGTGG - Intronic
1108711732 13:53039773-53039795 TTGGATGTACCATAACTCGGAGG - Intronic
1111534291 13:89581736-89581758 TTGGTTGTCCCGAAATATGTAGG + Intergenic
1111615741 13:90659419-90659441 TTGGTTTTCCCTGAACCTGGAGG - Intergenic
1111770430 13:92589222-92589244 CCGGCTGTACCAAAACTTGGAGG + Intronic
1115437924 14:33397651-33397673 TTGGTTCTCCCAAGACATGTAGG + Intronic
1115636728 14:35297067-35297089 TTGCTTTTCCCTAAACTTGTAGG - Intronic
1128527927 15:68425056-68425078 TTGGAATTCCCAGAACTTGGAGG + Intronic
1131756273 15:95565933-95565955 TTTGTTCTCCCCAAATTTGGTGG - Intergenic
1131941502 15:97571376-97571398 TTGGTTTTCCCAACACTGTGAGG - Intergenic
1133404286 16:5510494-5510516 TTGCTTTGGCCAAAACTTGGTGG - Intergenic
1137749600 16:50849759-50849781 TTGGTTTTCCCAACATTTGTTGG - Intergenic
1143897314 17:10146101-10146123 CTGGTTCTCCCCAAACTCGGGGG + Intronic
1149186229 17:54001096-54001118 ATGGTTTTACAAAAACTTGGTGG - Intergenic
1150909410 17:69372163-69372185 TTGATTGTCCCCAGATTTGGGGG - Intergenic
1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG + Intronic
1151955868 17:77379921-77379943 TTGGTTTTTCCCAAATTTGGAGG + Intronic
1158802846 18:60932912-60932934 TTGGTTGTACTAAAACTGGCTGG - Intergenic
1162792254 19:13069221-13069243 TTGGGTGGCCCTGAACTTGGGGG + Intronic
1168366117 19:55789067-55789089 TTCTTTTGCCCAAAACTTGGAGG - Intronic
928393789 2:30929036-30929058 TTGGATGACCTAGAACTTGGAGG + Intronic
929464872 2:42135302-42135324 GGGGTTGTCCCAAAAATTAGGGG + Intergenic
931181553 2:59906470-59906492 CTGGTTGTTCCAACTCTTGGAGG - Intergenic
933657512 2:84901852-84901874 TTGATTTTCTCACAACTTGGAGG + Intronic
936543726 2:113372761-113372783 GTGGTAGTCCCATAACATGGAGG + Intergenic
936759705 2:115761527-115761549 GGGGTTCTACCAAAACTTGGTGG + Intronic
938710473 2:133972344-133972366 CTGTTTGTTCCAAACCTTGGTGG - Intergenic
940615029 2:156038918-156038940 TTGGGTGCTCCAAAGCTTGGAGG - Intergenic
943212842 2:184989930-184989952 ATGGCTGCCCCAAACCTTGGGGG + Intergenic
945248964 2:207747135-207747157 CTGATCGTCCCAAACCTTGGAGG - Exonic
948135930 2:235636326-235636348 GTGGTCATCCCAAAAATTGGGGG - Intronic
1169249107 20:4046595-4046617 TGGGTTTTTCCAGAACTTGGAGG + Intergenic
1169731247 20:8787384-8787406 TTGGCTGTCTCAAAAGTTTGTGG + Intronic
1171126008 20:22602723-22602745 TTGGTTGTCCCACAGCTTGGGGG + Intergenic
1172847570 20:37938906-37938928 TGGGTTTTCCCAAGACATGGAGG + Intronic
1173113245 20:40215958-40215980 TTCTTTACCCCAAAACTTGGTGG - Intergenic
951094659 3:18614744-18614766 TTAGTTATCCCAAAACTCAGTGG + Intergenic
952058113 3:29473789-29473811 TTGGTGGGCCCCACACTTGGAGG - Intronic
954025695 3:47781660-47781682 CGGGCTCTCCCAAAACTTGGTGG + Exonic
954782464 3:53071696-53071718 TTGGTTGTCCCAATACTGCTGGG - Intronic
960371819 3:116850205-116850227 TTGGTTGTCCCAACTTGTGGTGG + Intronic
963043979 3:141089132-141089154 TGGGTTGGTCCCAAACTTGGAGG - Intronic
963082168 3:141404124-141404146 TTTGTAACCCCAAAACTTGGTGG - Intronic
966142675 3:176773310-176773332 TTGTTTGTTCCAAATCTTTGAGG - Intergenic
967121177 3:186384194-186384216 TGGCTTGTGGCAAAACTTGGGGG - Intergenic
968428482 4:538305-538327 TTGGTGGTTTCAAAACTAGGGGG + Intronic
971950567 4:33340221-33340243 TTGGTCGTCCCTAATCTGGGTGG + Intergenic
973023989 4:45243283-45243305 TTTCGTGTCCCAAAACTGGGAGG + Intergenic
974199837 4:58623425-58623447 TTGGATTTCCCAGTACTTGGAGG - Intergenic
974841737 4:67307170-67307192 TTGGTTGTCAGGAAACTGGGTGG - Intergenic
978578051 4:110205618-110205640 TTGTATGTCACAAAAATTGGGGG - Intergenic
978675012 4:111302520-111302542 TGTATTGTCCCAAAACTTTGTGG + Intergenic
981243677 4:142508794-142508816 TTGGTTCTCCCAAAAAAAGGAGG + Intronic
982551863 4:156811829-156811851 TAGGTTGTCTCAATAATTGGGGG + Intronic
983880507 4:172926997-172927019 TTGCTTGTCTCACAATTTGGAGG + Intronic
986321984 5:6639006-6639028 TTCATTGTTCCCAAACTTGGGGG + Intronic
987473840 5:18366018-18366040 TTTTTTTTTCCAAAACTTGGTGG + Intergenic
988333595 5:29875595-29875617 TTGGTGGTCCCAAGACATAGTGG - Intergenic
989347580 5:40447014-40447036 CTGGTTGACCCAGGACTTGGAGG + Intergenic
990972302 5:61522008-61522030 TTGGTTGTCCCAAAACTTGGAGG - Intronic
991164001 5:63540262-63540284 TTGGTTGTCCCCAAACTTTTTGG - Intergenic
991322823 5:65394477-65394499 TAAGTTGCCCCAAAACTTGGTGG - Intronic
992335134 5:75759617-75759639 TTGGTTGAAGCAAGACTTGGGGG + Intergenic
994854880 5:105105810-105105832 TTGGTGCTCCCAAAATTTGGAGG + Intergenic
996416211 5:123213317-123213339 TTGTTTTTCCCAACACTTAGAGG + Intergenic
997366582 5:133329237-133329259 TTGGTTGTCACAATGATTGGAGG + Intronic
1000956901 5:167554151-167554173 TTTGTTGTCCATAAAATTGGAGG - Intronic
1001300483 5:170530081-170530103 TTGTTTGTCCTAACCCTTGGAGG + Intronic
1002940468 6:1711159-1711181 TGGGTTGTCCCTAACCTTGTTGG - Intronic
1005165318 6:22913196-22913218 TTGGTTTTCCCAATAATTGAGGG - Intergenic
1005360975 6:25030413-25030435 TGGGGTGCCCCAGAACTTGGGGG + Intronic
1005526466 6:26656134-26656156 TTGGTTTTCAAAAAACATGGTGG + Intronic
1005830783 6:29669748-29669770 TTGTTTTTTCCAAGACTTGGGGG + Intronic
1006365093 6:33610634-33610656 TTGCTTGTCTCAAAAGTTAGAGG + Intergenic
1008713460 6:54258198-54258220 TTGTTTCTTCCTAAACTTGGAGG - Intronic
1009244454 6:61218640-61218662 CTGGCTGTCACTAAACTTGGAGG + Intergenic
1011137945 6:84119604-84119626 TTGGTTATCCCTAATGTTGGTGG - Intergenic
1013734543 6:113210190-113210212 TGGTTTGTCCCAAAAGTTGTTGG + Intergenic
1018360732 6:163065078-163065100 TGGGTTATTCCAGAACTTGGGGG - Intronic
1022637205 7:32147707-32147729 GTGGTTGTCTCAATGCTTGGAGG - Intronic
1023135546 7:37048210-37048232 TTGGTTGTCCCAACTTGTGGGGG - Intronic
1024478483 7:49839405-49839427 TTGGTTGTCCTCAAATTTGATGG - Intronic
1030720817 7:112868513-112868535 CTGTTTCTCCCAAAACTGGGAGG + Intronic
1032333156 7:130999297-130999319 TTGGTTTCCCCAAAACTGGGAGG + Intergenic
1033132794 7:138759668-138759690 TTCGTTCTCCCAAAACATGGGGG - Intronic
1035456068 7:159009686-159009708 TTGGAGGTGCCAAAACTAGGTGG - Intergenic
1037062835 8:14537350-14537372 TAGGTTGCCCCAAAACTGAGTGG - Intronic
1038373764 8:27017133-27017155 TTGGTTGTCATAGAAATTGGGGG + Intergenic
1038940592 8:32300037-32300059 TAGGTTGTCTCTAAACTAGGTGG - Intronic
1041655881 8:60350086-60350108 TTGGTTCTCCCAAAATTAGTAGG - Intergenic
1046279540 8:112007685-112007707 TTGGTTGCTCCAGAATTTGGAGG - Intergenic
1046641155 8:116733263-116733285 TTGGGTTTCCAAACACTTGGAGG - Intronic
1046996802 8:120532681-120532703 TTGGTTGTCACAATAATTGGGGG - Intronic
1050240118 9:3626113-3626135 TTGGTTTTCCCCATACCTGGAGG + Intergenic
1058514196 9:105752514-105752536 TTGGTTTTTCCCAAACCTGGAGG - Intronic
1059641390 9:116220052-116220074 TTGTGTGGCCCAGAACTTGGGGG - Exonic
1061935320 9:133854379-133854401 TTTGTTCTGCCTAAACTTGGAGG + Intronic
1062709280 9:137964994-137965016 TTGGTTTTCCCTGTACTTGGTGG + Intronic
1185663638 X:1746612-1746634 TTGATTCTCCCAAGTCTTGGAGG - Intergenic
1185780275 X:2837960-2837982 TTGTTTGACCCAGAAGTTGGAGG - Intronic
1186607779 X:11110015-11110037 TTGTTTTTCCCAAAATTTGCTGG - Intergenic
1187583231 X:20631667-20631689 TTGGTTGTTCCAACATGTGGTGG + Intergenic
1187864960 X:23715523-23715545 TTTGTTGTCACATAACTTGGGGG + Intronic
1190816580 X:53935029-53935051 TTGGTTGCCCCTAAACTTTCTGG - Intergenic
1192435107 X:71138226-71138248 CTGGTAGTCCCAGCACTTGGGGG + Intronic
1193376507 X:80767585-80767607 CTGGTTTTTCCAAATCTTGGTGG - Intronic
1195415929 X:104619353-104619375 TTGTTTCTCCCAAGACCTGGAGG - Intronic
1195496687 X:105543526-105543548 TTGGTTTTCACATAACCTGGAGG + Intronic
1198553833 X:137772088-137772110 TTTGTTATCCCACCACTTGGAGG - Intergenic
1202040097 Y:20673976-20673998 TTGTTTTTCTCAAAACCTGGAGG + Intergenic