ID: 990972302

View in Genome Browser
Species Human (GRCh38)
Location 5:61522008-61522030
Sequence TTGGTTGTCCCAAAACTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990972302 Original CRISPR TTGGTTGTCCCAAAACTTGG AGG (reversed) Intronic