ID: 990972563

View in Genome Browser
Species Human (GRCh38)
Location 5:61525068-61525090
Sequence CCCTGGCATACACTATGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990972558_990972563 13 Left 990972558 5:61525032-61525054 CCTCTTCGGAGTGTATGGCTCTG 0: 1
1: 0
2: 0
3: 3
4: 81
Right 990972563 5:61525068-61525090 CCCTGGCATACACTATGCTGGGG 0: 1
1: 0
2: 1
3: 8
4: 100
990972554_990972563 27 Left 990972554 5:61525018-61525040 CCTGAAACTTGAACCCTCTTCGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 990972563 5:61525068-61525090 CCCTGGCATACACTATGCTGGGG 0: 1
1: 0
2: 1
3: 8
4: 100
990972557_990972563 14 Left 990972557 5:61525031-61525053 CCCTCTTCGGAGTGTATGGCTCT 0: 1
1: 0
2: 0
3: 4
4: 66
Right 990972563 5:61525068-61525090 CCCTGGCATACACTATGCTGGGG 0: 1
1: 0
2: 1
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990972563 Original CRISPR CCCTGGCATACACTATGCTG GGG Intronic
902711452 1:18242865-18242887 CCCTGGCTCACACTCTGCTGGGG + Intronic
906133324 1:43475695-43475717 CACTGGCATAGACCATGCGGGGG - Intergenic
907258014 1:53195014-53195036 CCCTGGCATAGAGTATTTTGGGG + Intergenic
908587937 1:65594368-65594390 CCCTGGCCTACAATATGCTCTGG - Intronic
913054144 1:115141926-115141948 CCCAGGCATACTATGTGCTGGGG - Intergenic
914682659 1:149950110-149950132 TCGTGGCAGACACCATGCTGAGG - Exonic
920310542 1:205045720-205045742 CCCTGGCATATTCTTTGCTCTGG - Intronic
921507321 1:215988339-215988361 TCCTGTCATACAATATGCTCTGG - Intronic
1064284400 10:13980003-13980025 CCACGGCATTCACAATGCTGGGG + Intronic
1065023454 10:21519101-21519123 CCCTGGCAAAGGCTTTGCTGGGG - Exonic
1079963839 11:26956249-26956271 CCGTGGCAAACCCTATGCTATGG - Intergenic
1081542169 11:44043301-44043323 CCCTGGCAACCACTAGTCTGAGG + Intergenic
1083299017 11:61730583-61730605 AGCTGGCAGACACTTTGCTGGGG + Intronic
1083457880 11:62791210-62791232 CCCTGTCATAGCCTAGGCTGAGG - Intronic
1083961139 11:66015698-66015720 CCCAGGAATAGACTATGCGGAGG - Intergenic
1088813096 11:113404688-113404710 CTCTGCCCTACACTTTGCTGTGG - Intergenic
1089650289 11:119908426-119908448 CCCTGGCTTTCACACTGCTGGGG - Intergenic
1095427022 12:42086542-42086564 ACTTAGCATATACTATGCTGGGG - Exonic
1098006896 12:66007175-66007197 CTCTGTCATACACTAAGCTTTGG - Intergenic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1105323955 13:19353398-19353420 TCCTGGCCTACACGATGCTACGG - Intergenic
1105323969 13:19353511-19353533 TCCTGGCCTACACGATGCTACGG - Intergenic
1105323983 13:19353624-19353646 TCCTGGCCTACACGATGCTACGG - Intergenic
1105323997 13:19353737-19353759 TCCTGGCCTACACGATGCTACGG - Intergenic
1105869983 13:24496024-24496046 TCCTGGCCTACACGATGCTACGG + Intronic
1111917808 13:94379744-94379766 CCCTGGAATCCCCTAAGCTGTGG + Intronic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1117023980 14:51601137-51601159 CCCCAGCATCCACTATGCTTTGG + Intronic
1119762696 14:77163134-77163156 CCCTGGCATTGACTATGCATGGG + Intronic
1122438430 14:101713950-101713972 CCCTGGCTTGCACTATGCTATGG + Intergenic
1128378028 15:67091146-67091168 CCCTGGCACACACATTGCTATGG + Intronic
1129681747 15:77662163-77662185 CCCTGGCCTACACAGTTCTGGGG + Intronic
1130231179 15:82098218-82098240 CCCTTGCACACACTAAGATGGGG - Intergenic
1131168223 15:90158167-90158189 CCCAGACATACACTCTGCTGCGG - Intergenic
1132014061 15:98300399-98300421 CCCTTGCATCCACTTTGCTCTGG + Intergenic
1132336832 15:101053214-101053236 CCCTGGCAGACACCATGCTGAGG + Exonic
1132729699 16:1355416-1355438 CCTTGGCAGACACTCTTCTGCGG - Intronic
1132918696 16:2370357-2370379 CCTGGCCATACAGTATGCTGTGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1203137561 16_KI270728v1_random:1738664-1738686 CCATGGACTACACAATGCTGTGG - Intergenic
1144131584 17:12251800-12251822 CCTGGGCATACAAAATGCTGTGG - Intergenic
1144585970 17:16487983-16488005 CCCTGGGATACACCCAGCTGAGG - Intronic
1144851429 17:18246017-18246039 CCCAGGCATACACGATGCCCTGG + Exonic
1145858236 17:28183271-28183293 CCCTGACCTTCACTATGCTTTGG - Intronic
1148676848 17:49450791-49450813 CCCTGGCACACAGCGTGCTGTGG + Intronic
1157490384 18:48119762-48119784 GCCTGGCAGACACTTTGGTGAGG + Intronic
1158571902 18:58603425-58603447 CCCTGGCATCGGCTAGGCTGGGG - Intronic
1160298046 18:77655574-77655596 CCCAGGCATGCGCCATGCTGTGG - Intergenic
1163566342 19:18053856-18053878 CCCTGACACACACTATAATGAGG + Intergenic
1166025248 19:40077118-40077140 TACCAGCATACACTATGCTGGGG + Intronic
925820662 2:7796547-7796569 CTCTGGCAAACCCCATGCTGGGG - Intergenic
934232961 2:90202696-90202718 CCCTGGCATAAACTAGTCTGGGG + Intergenic
934907282 2:98216445-98216467 CCCTCACATACCCTATGCTAAGG - Intronic
938187938 2:129249809-129249831 CCCTGGGATACTCTAAGCAGAGG - Intergenic
940737939 2:157474223-157474245 ACCAGGCATCCATTATGCTGAGG + Intronic
946606215 2:221408402-221408424 CCCTTGCCTCCCCTATGCTGTGG + Intergenic
1170786359 20:19471041-19471063 CCCTGACACACCCTCTGCTGGGG - Intronic
1175849435 20:62080927-62080949 CATTGGCAGACACTATGCTTCGG + Intergenic
1178678009 21:34647365-34647387 CCCTGGCATACTCCTTGCTCTGG + Intergenic
949174341 3:1040477-1040499 CAATGTAATACACTATGCTGAGG - Intergenic
951804863 3:26632843-26632865 CCTTGGCATACCCTGTGCTCTGG + Intronic
964344889 3:155745248-155745270 CCTTGGCTTACACTCTCCTGCGG + Intergenic
966801975 3:183772536-183772558 CCCTGGGATCCACTCTTCTGAGG - Exonic
968323895 3:197795319-197795341 CACTGGCATACCCTATGCCAGGG - Intronic
969633086 4:8349856-8349878 CCTTTGCAAACACAATGCTGTGG - Intergenic
969684636 4:8664294-8664316 GCCTGGCTTACACTAGGCTGTGG - Intergenic
974336541 4:60553672-60553694 CAATGGCTTACATTATGCTGAGG - Intergenic
983744545 4:171181317-171181339 GCCTGGCATATATTATGCTGTGG + Intergenic
983971346 4:173878643-173878665 CCTTGGCACACAATATCCTGAGG - Intergenic
984583323 4:181535011-181535033 CCCTGGCTAACCCTATGCAGCGG + Intergenic
985102674 4:186474093-186474115 GCCTGCCGTACACTTTGCTGGGG + Intronic
988164526 5:27568172-27568194 CACTGGCATGTACTATGTTGGGG - Intergenic
988842009 5:35092523-35092545 GGCTGGCAGACACTAAGCTGGGG + Intronic
990669148 5:58107780-58107802 CCTAGGCATACAATTTGCTGAGG + Intergenic
990972563 5:61525068-61525090 CCCTGGCATACACTATGCTGGGG + Intronic
992236367 5:74713608-74713630 CCTGGGCATACACTATCTTGGGG + Exonic
997367683 5:133336309-133336331 CCCTGCCTTCCACTACGCTGAGG + Intronic
998037931 5:138932404-138932426 CCCTTGCCTACACTCTGCTTGGG - Intronic
998372328 5:141669955-141669977 CCCAGACATACAATATCCTGGGG + Exonic
999573938 5:152952966-152952988 CCCTGGCAACCACTAATCTGTGG - Intergenic
1002808585 6:603193-603215 TCCTGGGATACATTGTGCTGTGG - Intronic
1003092701 6:3117792-3117814 ACCTGGAGGACACTATGCTGAGG - Intergenic
1006058248 6:31401362-31401384 CCCTAGCCTACACTTTTCTGTGG - Intronic
1006070630 6:31495573-31495595 CCCTAGCCTACACTTTTCTGTGG - Intronic
1006600152 6:35219881-35219903 CCCTTGGATTCACTATGCTGGGG - Intronic
1008563519 6:52745041-52745063 CCATGGCATACCCCATGCTAGGG - Intergenic
1009452136 6:63813705-63813727 CCCTGGTGTCCACTCTGCTGAGG - Intronic
1012396891 6:98808924-98808946 GCGGGGCATACACAATGCTGAGG - Intergenic
1017694681 6:157002977-157002999 TCCTGGAATACACCATGCTCTGG - Intronic
1018186355 6:161268291-161268313 ACCTGGCATAAACTAGACTGAGG + Intronic
1021423528 7:20472399-20472421 CCCTGCCATGCCCTATGCTCTGG - Intergenic
1027516914 7:79153675-79153697 CCATGGCTTCCACTATGCTTAGG - Intronic
1031268166 7:119609286-119609308 TCCTGCCATACACTACTCTGTGG - Intergenic
1032087760 7:128892738-128892760 CATTGGCATACACTTGGCTGTGG + Exonic
1035785544 8:2257282-2257304 TGCTTGCATACACTATGCTTAGG - Intergenic
1035807264 8:2464434-2464456 TGCTTGCATACACTATGCTTAGG + Intergenic
1038124154 8:24652535-24652557 CCCTGGCAAACACTTGTCTGTGG + Intergenic
1045624703 8:104030151-104030173 CCATGCCATACACAATGCTCTGG - Intronic
1048878349 8:138854116-138854138 TCCTGGCACACACTGTCCTGTGG - Intronic
1049142672 8:140970297-140970319 CTCATGGATACACTATGCTGGGG + Intronic
1050366562 9:4878784-4878806 TGCTGGCATACAGTATGGTGTGG + Intronic
1052556088 9:30019873-30019895 CCCTGGCTTAAACTAACCTGAGG + Intergenic
1053200597 9:36149377-36149399 CCCTGGCTTAGGCTGTGCTGGGG - Intronic
1055002515 9:71468326-71468348 GCCTGGCAAACACTAATCTGCGG + Intergenic
1059217217 9:112575231-112575253 ACCTGGTATGCACTGTGCTGTGG - Exonic
1060529971 9:124342298-124342320 CCCGACCATCCACTATGCTGCGG - Intronic
1185977846 X:4741233-4741255 CCCTGGCAACCACCATTCTGTGG - Intergenic
1188392881 X:29642729-29642751 CCCTGGAATACACAATCTTGTGG - Intronic
1188546239 X:31310665-31310687 CCCAGGCACACAGGATGCTGAGG - Intronic
1200383562 X:155865554-155865576 CACTGGCAGTCACTGTGCTGCGG - Intergenic