ID: 990976342

View in Genome Browser
Species Human (GRCh38)
Location 5:61564854-61564876
Sequence CTTTGGGAATGAAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990976342_990976353 18 Left 990976342 5:61564854-61564876 CCTTCTCCCCTTCATTCCCAAAG No data
Right 990976353 5:61564895-61564917 TGGGCAGGCTCCTAAGTATTTGG No data
990976342_990976350 -1 Left 990976342 5:61564854-61564876 CCTTCTCCCCTTCATTCCCAAAG No data
Right 990976350 5:61564876-61564898 GGTCCAATTACACAGTTTCTGGG No data
990976342_990976349 -2 Left 990976342 5:61564854-61564876 CCTTCTCCCCTTCATTCCCAAAG No data
Right 990976349 5:61564875-61564897 AGGTCCAATTACACAGTTTCTGG No data
990976342_990976352 3 Left 990976342 5:61564854-61564876 CCTTCTCCCCTTCATTCCCAAAG No data
Right 990976352 5:61564880-61564902 CAATTACACAGTTTCTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990976342 Original CRISPR CTTTGGGAATGAAGGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr