ID: 990977027

View in Genome Browser
Species Human (GRCh38)
Location 5:61569350-61569372
Sequence CCCAGAGTGCTGAGCGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990977027_990977030 16 Left 990977027 5:61569350-61569372 CCCTGAGCGCTCAGCACTCTGGG No data
Right 990977030 5:61569389-61569411 CAGCCACCCTGCCCAGAGCCAGG No data
990977027_990977035 27 Left 990977027 5:61569350-61569372 CCCTGAGCGCTCAGCACTCTGGG No data
Right 990977035 5:61569400-61569422 CCCAGAGCCAGGCGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990977027 Original CRISPR CCCAGAGTGCTGAGCGCTCA GGG (reversed) Intergenic
No off target data available for this crispr