ID: 990977029

View in Genome Browser
Species Human (GRCh38)
Location 5:61569351-61569373
Sequence TCCCAGAGTGCTGAGCGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990977029_990977030 15 Left 990977029 5:61569351-61569373 CCTGAGCGCTCAGCACTCTGGGA No data
Right 990977030 5:61569389-61569411 CAGCCACCCTGCCCAGAGCCAGG No data
990977029_990977035 26 Left 990977029 5:61569351-61569373 CCTGAGCGCTCAGCACTCTGGGA No data
Right 990977035 5:61569400-61569422 CCCAGAGCCAGGCGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990977029 Original CRISPR TCCCAGAGTGCTGAGCGCTC AGG (reversed) Intergenic
No off target data available for this crispr