ID: 990977035

View in Genome Browser
Species Human (GRCh38)
Location 5:61569400-61569422
Sequence CCCAGAGCCAGGCGCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990977029_990977035 26 Left 990977029 5:61569351-61569373 CCTGAGCGCTCAGCACTCTGGGA No data
Right 990977035 5:61569400-61569422 CCCAGAGCCAGGCGCCTTCCTGG No data
990977027_990977035 27 Left 990977027 5:61569350-61569372 CCCTGAGCGCTCAGCACTCTGGG No data
Right 990977035 5:61569400-61569422 CCCAGAGCCAGGCGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990977035 Original CRISPR CCCAGAGCCAGGCGCCTTCC TGG Intergenic
No off target data available for this crispr