ID: 990980024

View in Genome Browser
Species Human (GRCh38)
Location 5:61593910-61593932
Sequence AGGTGGGTATAGAAGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990980024_990980033 20 Left 990980024 5:61593910-61593932 CCACCATCCTTCTATACCCACCT No data
Right 990980033 5:61593953-61593975 CTGGGTGTATTCACACCTCCAGG No data
990980024_990980030 1 Left 990980024 5:61593910-61593932 CCACCATCCTTCTATACCCACCT No data
Right 990980030 5:61593934-61593956 CTCTCAGCTCCTGACTGTGCTGG No data
990980024_990980031 2 Left 990980024 5:61593910-61593932 CCACCATCCTTCTATACCCACCT No data
Right 990980031 5:61593935-61593957 TCTCAGCTCCTGACTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990980024 Original CRISPR AGGTGGGTATAGAAGGATGG TGG (reversed) Intergenic
No off target data available for this crispr