ID: 990981060

View in Genome Browser
Species Human (GRCh38)
Location 5:61602785-61602807
Sequence CACTCTTAAAGCAGTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990981053_990981060 14 Left 990981053 5:61602748-61602770 CCTATTGGTCTGGACTGGCCAGA No data
Right 990981060 5:61602785-61602807 CACTCTTAAAGCAGTCCTGGTGG No data
990981056_990981060 -4 Left 990981056 5:61602766-61602788 CCAGACATGAGCCATGGGCCACT No data
Right 990981060 5:61602785-61602807 CACTCTTAAAGCAGTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990981060 Original CRISPR CACTCTTAAAGCAGTCCTGG TGG Intergenic
No off target data available for this crispr