ID: 990982951

View in Genome Browser
Species Human (GRCh38)
Location 5:61618034-61618056
Sequence GACTCCATAGAGTCTAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990982951_990982954 19 Left 990982951 5:61618034-61618056 CCAAATCTAGACTCTATGGAGTC No data
Right 990982954 5:61618076-61618098 ATCTTGTCCATTGTTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990982951 Original CRISPR GACTCCATAGAGTCTAGATT TGG (reversed) Intergenic
No off target data available for this crispr