ID: 990982954

View in Genome Browser
Species Human (GRCh38)
Location 5:61618076-61618098
Sequence ATCTTGTCCATTGTTCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990982951_990982954 19 Left 990982951 5:61618034-61618056 CCAAATCTAGACTCTATGGAGTC No data
Right 990982954 5:61618076-61618098 ATCTTGTCCATTGTTCCTCTTGG No data
990982953_990982954 -3 Left 990982953 5:61618056-61618078 CCAGGAATGACAACAATCTCATC No data
Right 990982954 5:61618076-61618098 ATCTTGTCCATTGTTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990982954 Original CRISPR ATCTTGTCCATTGTTCCTCT TGG Intergenic