ID: 990984082

View in Genome Browser
Species Human (GRCh38)
Location 5:61626034-61626056
Sequence TGCAGCGACCACGGCCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990984082_990984094 28 Left 990984082 5:61626034-61626056 CCTGAGGGGCCGTGGTCGCTGCA No data
Right 990984094 5:61626085-61626107 TAGGAGACCGGAAAGGTGCAGGG No data
990984082_990984091 21 Left 990984082 5:61626034-61626056 CCTGAGGGGCCGTGGTCGCTGCA No data
Right 990984091 5:61626078-61626100 TGGCCAATAGGAGACCGGAAAGG No data
990984082_990984086 9 Left 990984082 5:61626034-61626056 CCTGAGGGGCCGTGGTCGCTGCA No data
Right 990984086 5:61626066-61626088 AGACCCCTAGATTGGCCAATAGG No data
990984082_990984084 1 Left 990984082 5:61626034-61626056 CCTGAGGGGCCGTGGTCGCTGCA No data
Right 990984084 5:61626058-61626080 TTTGTCCGAGACCCCTAGATTGG No data
990984082_990984090 16 Left 990984082 5:61626034-61626056 CCTGAGGGGCCGTGGTCGCTGCA No data
Right 990984090 5:61626073-61626095 TAGATTGGCCAATAGGAGACCGG No data
990984082_990984093 27 Left 990984082 5:61626034-61626056 CCTGAGGGGCCGTGGTCGCTGCA No data
Right 990984093 5:61626084-61626106 ATAGGAGACCGGAAAGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990984082 Original CRISPR TGCAGCGACCACGGCCCCTC AGG (reversed) Intergenic
No off target data available for this crispr