ID: 990984153

View in Genome Browser
Species Human (GRCh38)
Location 5:61626254-61626276
Sequence TCGGGGGTTCCTGGGCCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990984147_990984153 -9 Left 990984147 5:61626240-61626262 CCTAAGCCGGGAAGTCGGGGGTT No data
Right 990984153 5:61626254-61626276 TCGGGGGTTCCTGGGCCGGGTGG No data
990984136_990984153 11 Left 990984136 5:61626220-61626242 CCTCCGCCGAGCCCAGCTTTCCT No data
Right 990984153 5:61626254-61626276 TCGGGGGTTCCTGGGCCGGGTGG No data
990984142_990984153 -1 Left 990984142 5:61626232-61626254 CCAGCTTTCCTAAGCCGGGAAGT No data
Right 990984153 5:61626254-61626276 TCGGGGGTTCCTGGGCCGGGTGG No data
990984137_990984153 8 Left 990984137 5:61626223-61626245 CCGCCGAGCCCAGCTTTCCTAAG No data
Right 990984153 5:61626254-61626276 TCGGGGGTTCCTGGGCCGGGTGG No data
990984135_990984153 17 Left 990984135 5:61626214-61626236 CCTGGGCCTCCGCCGAGCCCAGC No data
Right 990984153 5:61626254-61626276 TCGGGGGTTCCTGGGCCGGGTGG No data
990984134_990984153 18 Left 990984134 5:61626213-61626235 CCCTGGGCCTCCGCCGAGCCCAG No data
Right 990984153 5:61626254-61626276 TCGGGGGTTCCTGGGCCGGGTGG No data
990984138_990984153 5 Left 990984138 5:61626226-61626248 CCGAGCCCAGCTTTCCTAAGCCG No data
Right 990984153 5:61626254-61626276 TCGGGGGTTCCTGGGCCGGGTGG No data
990984141_990984153 0 Left 990984141 5:61626231-61626253 CCCAGCTTTCCTAAGCCGGGAAG No data
Right 990984153 5:61626254-61626276 TCGGGGGTTCCTGGGCCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990984153 Original CRISPR TCGGGGGTTCCTGGGCCGGG TGG Intergenic
No off target data available for this crispr