ID: 990985502

View in Genome Browser
Species Human (GRCh38)
Location 5:61637808-61637830
Sequence CAGAATAATTGGGAGGAGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 215}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990985497_990985502 -3 Left 990985497 5:61637788-61637810 CCTCAGGGCAAAGAAGCCTGCAG 0: 1
1: 0
2: 2
3: 24
4: 293
Right 990985502 5:61637808-61637830 CAGAATAATTGGGAGGAGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 215
990985491_990985502 21 Left 990985491 5:61637764-61637786 CCAGTCCCTGGAGCTGCAAACTG 0: 1
1: 1
2: 0
3: 13
4: 188
Right 990985502 5:61637808-61637830 CAGAATAATTGGGAGGAGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 215
990985490_990985502 27 Left 990985490 5:61637758-61637780 CCAATTCCAGTCCCTGGAGCTGC 0: 1
1: 1
2: 16
3: 124
4: 491
Right 990985502 5:61637808-61637830 CAGAATAATTGGGAGGAGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 215
990985496_990985502 -2 Left 990985496 5:61637787-61637809 CCCTCAGGGCAAAGAAGCCTGCA 0: 1
1: 1
2: 2
3: 7
4: 173
Right 990985502 5:61637808-61637830 CAGAATAATTGGGAGGAGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 215
990985493_990985502 15 Left 990985493 5:61637770-61637792 CCTGGAGCTGCAAACTGCCCTCA 0: 1
1: 0
2: 0
3: 20
4: 218
Right 990985502 5:61637808-61637830 CAGAATAATTGGGAGGAGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 215
990985492_990985502 16 Left 990985492 5:61637769-61637791 CCCTGGAGCTGCAAACTGCCCTC 0: 1
1: 1
2: 4
3: 17
4: 187
Right 990985502 5:61637808-61637830 CAGAATAATTGGGAGGAGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990985502 Original CRISPR CAGAATAATTGGGAGGAGTC TGG Exonic
901155397 1:7134051-7134073 CAGACTACCTGGGGGGAGTCAGG - Intronic
901605570 1:10456332-10456354 CAGACCTATTGGGAGGACTCAGG + Intergenic
902083277 1:13836109-13836131 CAGATAAATTTGGAGGAGTGGGG + Intergenic
902809743 1:18881344-18881366 CAGAATGAACTGGAGGAGTCAGG - Intronic
905676646 1:39830568-39830590 GAGAATAATGGGCAGGAGCCAGG - Intergenic
906349555 1:45046264-45046286 CAGAAGAAGAGGGAGAAGTCAGG + Intronic
907685682 1:56609168-56609190 CATAATAGTTGGGTGGAGGCAGG - Intronic
908715853 1:67068465-67068487 CATAAGATTTGGGAGGAGCCAGG + Intergenic
909108156 1:71439141-71439163 CACAATTATTTGGAGTAGTCTGG - Intronic
909751539 1:79166880-79166902 CAGACTTATTCGGAGAAGTCTGG + Intergenic
911285217 1:95983324-95983346 AAGAATAATTTGTAGGGGTCGGG + Intergenic
912182808 1:107238478-107238500 CATAAGAATTGGGAGGAGCCAGG + Intronic
913384187 1:118241713-118241735 GAGAAAAAGAGGGAGGAGTCAGG - Intergenic
914243285 1:145867105-145867127 GAGAATCACTGGGTGGAGTCAGG - Intronic
916481850 1:165221393-165221415 CAGGATAGTTGGGGGGAGTTGGG - Intronic
922571194 1:226635590-226635612 CAGAGTGTTTGGGAGGAGTCAGG - Intronic
1064559149 10:16578675-16578697 CAGAATAACATGGAGGAGGCAGG - Intergenic
1065725562 10:28665021-28665043 CAGAAAACTTGGGAGGGGACTGG + Intergenic
1066373712 10:34838666-34838688 CAGATGAATTGGGTGGAGGCAGG + Intergenic
1069339983 10:67398610-67398632 CACAAGATTTGGGAGGAGCCAGG + Intronic
1069842151 10:71346684-71346706 TAGAATGAAAGGGAGGAGTCAGG + Intronic
1070012084 10:72485498-72485520 CAGAATGGTTGGGAGGATTAAGG - Intronic
1070837483 10:79458994-79459016 CAGAATAACAGGCATGAGTCTGG - Intergenic
1072267618 10:93745615-93745637 CAGAATAACTGGGGCGAGGCAGG - Intergenic
1072616575 10:97053391-97053413 TAAATTAATTGGGAGGAGTTGGG + Intronic
1074512885 10:114134173-114134195 CAGAAAAAATGGGAGCTGTCAGG - Intronic
1078199486 11:9167355-9167377 CAGAATATTTTGGAGGAGGGTGG - Intronic
1078591256 11:12641978-12642000 GAGAATAATTAAGAGGAGGCTGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078830893 11:14975282-14975304 CAAATAAAATGGGAGGAGTCTGG - Intronic
1080720122 11:34840526-34840548 TAGAATAATTTAGAGGACTCAGG - Intergenic
1080959754 11:37145104-37145126 CATGATATTTGGGAGGGGTCAGG - Intergenic
1085269095 11:75259645-75259667 CAGAACATATGGGAGGAGTAAGG - Intergenic
1086309442 11:85519680-85519702 CATAAGATTTGGGAGGGGTCAGG + Intronic
1086419877 11:86628283-86628305 CCGAAGTATTGGGAGGAGGCTGG - Intronic
1087025779 11:93648237-93648259 CAGTATAAATGGGATGAGTTAGG - Intergenic
1087172648 11:95066858-95066880 TAGAATAATAGGGAGGAGCATGG + Intergenic
1087946553 11:104166637-104166659 CAGAATAATTGGTTGGGTTCAGG - Intergenic
1089493636 11:118898150-118898172 CATAGGAATTGGGAGGAGTGGGG + Exonic
1093303010 12:17477708-17477730 ACTAAGAATTGGGAGGAGTCAGG - Intergenic
1095852672 12:46828040-46828062 GAGAATGCTTGGGAGGAGGCTGG - Intronic
1097024771 12:56046711-56046733 CAGAAACATTGGGAGGGGTGTGG + Intergenic
1098065815 12:66614906-66614928 TAGAATAATTGAGAAGAGGCTGG - Intronic
1099606354 12:84806496-84806518 AAATCTAATTGGGAGGAGTCAGG + Intergenic
1102418318 12:112783785-112783807 CAGAATAATTGAGAGGGAGCTGG - Intronic
1102622488 12:114207403-114207425 TAAATTAATTGGCAGGAGTCTGG + Intergenic
1103861996 12:124022961-124022983 CAGAATAAATGGGGGAAATCTGG - Intronic
1104852072 12:131881440-131881462 AAGAATAATTGGGACGGGTGCGG - Intergenic
1105726913 13:23171989-23172011 CCGTATAATTGAAAGGAGTCAGG + Intergenic
1106054831 13:26228491-26228513 CAGAATACTTGGTAGGCCTCTGG - Intergenic
1106630936 13:31472334-31472356 CAAAATAATTCTCAGGAGTCTGG - Intergenic
1108430490 13:50348315-50348337 TAGAATAATTGGGAGGGATGGGG + Intronic
1109344770 13:61100845-61100867 CATAAGATTTGGGAGGAGCCAGG + Intergenic
1109571074 13:64191264-64191286 CAAAATAATTTAGAAGAGTCAGG + Intergenic
1113318764 13:109212151-109212173 AAGAATAATAGGGAGTGGTCGGG - Intergenic
1114798027 14:25739344-25739366 CATGATATTTGGGAGGGGTCGGG - Intergenic
1115113783 14:29855613-29855635 CAGGAGATTTGGGAGGAGCCAGG + Intronic
1115811853 14:37118389-37118411 AAAAATAGTTGGGAGGAGGCAGG - Intronic
1115944531 14:38644508-38644530 CATGATATTTGAGAGGAGTCAGG + Intergenic
1118966223 14:70588388-70588410 AAAAATAATTGGGAGGGGCCGGG + Intronic
1119706482 14:76785915-76785937 GAGAATTATTGGTAGGAGTTGGG - Intergenic
1119955842 14:78798041-78798063 CATAAGATTTGGGAGGGGTCAGG - Intronic
1120342314 14:83237233-83237255 CAGAATATTTGGGATGTATCGGG - Intergenic
1120495096 14:85225177-85225199 CAAAATAATTGAGAGGAGACAGG + Intergenic
1120800515 14:88683164-88683186 AAAAGTAATTGGGAGGAGACTGG + Intronic
1122338825 14:101011593-101011615 CAGAATATTAGGGTGGAGTTGGG - Intergenic
1127610016 15:60627480-60627502 GAGAATGATGGGGAGGAGTATGG + Intronic
1129177704 15:73852095-73852117 TTGAATAATGGGGAAGAGTCAGG - Intergenic
1135539018 16:23315839-23315861 CAGATTAAATGAGAGGACTCAGG - Intronic
1136798842 16:33050404-33050426 CAGAACACTTGGGAGGTGACCGG - Intergenic
1137704717 16:50526606-50526628 TAGAGTGATTGGGAGGAGTGGGG + Intergenic
1139293228 16:65876652-65876674 CAGAATAACTGGGAGGAGAGTGG + Intergenic
1144285367 17:13769358-13769380 CATAAGATTTGGGAGGAGCCAGG - Intergenic
1145314412 17:21720924-21720946 CTGAATATTTGGGAGGAGAACGG + Intergenic
1154335520 18:13461908-13461930 CAGAAAAAGTGGGAGGGGGCAGG + Intronic
1156465140 18:37343964-37343986 CTGAAAAATGGGGAGGAGTTTGG - Intronic
1158611546 18:58945041-58945063 CATAACAACTGGGAGGAATCTGG - Intronic
1160073130 18:75645664-75645686 CAGAAGAATGAGGAGGATTCCGG + Intergenic
1163724042 19:18912437-18912459 TAAAATAATTGGTAGGAGCCAGG - Intronic
1164503487 19:28839205-28839227 CAGAATAATTGGGGGGTGAAAGG - Intergenic
1165409651 19:35651424-35651446 CAGAATAAAAGGGAGGAGGCTGG - Intronic
1166419515 19:42625652-42625674 GAGATGAATTGGGAGGGGTCAGG + Intronic
1167640481 19:50678840-50678862 CAGGATGATGGGGAGGGGTCAGG + Intronic
928822112 2:35373606-35373628 CATAAGATTTGGGAGGAGCCAGG + Intergenic
929789396 2:45012374-45012396 CAGAATACTTGGGAGGTGTCTGG + Intergenic
930017559 2:46981459-46981481 CAGGCGAAATGGGAGGAGTCTGG + Intronic
930480699 2:51944548-51944570 CATGAGATTTGGGAGGAGTCAGG + Intergenic
930589125 2:53306061-53306083 CTGAAAAATTGGGAGGAGGAAGG + Intergenic
930946230 2:57079316-57079338 CAGCATGACTGGGAGGACTCAGG - Intergenic
931721488 2:65070400-65070422 CAGTATCATTGGGAGGTGACCGG + Intronic
933098967 2:78226230-78226252 CATGATATTTGGGAGGGGTCAGG - Intergenic
933551321 2:83780753-83780775 AAGAATTATTGAGAGGATTCCGG + Intergenic
935702696 2:105826119-105826141 CAGCATAACTGGGAGGCCTCAGG + Intronic
935755994 2:106276401-106276423 CAGACTGCTTGGGAAGAGTCCGG + Intergenic
940691444 2:156924852-156924874 CATGATATTTGGGAGGGGTCAGG + Intergenic
941133943 2:161689929-161689951 CAGAAAAGTTTTGAGGAGTCTGG - Intronic
941241610 2:163045670-163045692 TAGTATCATTAGGAGGAGTCTGG + Intergenic
941272455 2:163447867-163447889 CAGAATAGTTGGGAGAAGGGGGG + Intergenic
941356578 2:164500526-164500548 CAGATTATTTGGGAAGAATCAGG - Intronic
941893106 2:170602662-170602684 CAGAATAATTTAGAGGAGAGAGG - Intronic
941978082 2:171427299-171427321 AAGAATAATTGTAAGGAGACAGG - Intronic
943006437 2:182392482-182392504 CATGAGATTTGGGAGGAGTCAGG - Intronic
943457018 2:188120664-188120686 CTGAATAAGTGGAAGGATTCTGG + Intergenic
943883210 2:193174771-193174793 CATCATAATTGGGAGGACTGGGG - Intergenic
946328978 2:218999295-218999317 CAGAATAATTGGGGTGGGTGGGG + Intergenic
947814576 2:233027701-233027723 CGGAATAATCGGAATGAGTCAGG + Intergenic
1174659445 20:52198409-52198431 AAGAATAACAGGGAGGAGTGGGG - Intronic
1174724750 20:52849939-52849961 CAGCATAAATGGGAAGATTCTGG - Intergenic
1174730803 20:52915029-52915051 CAAAAAAATTGGCAGGAGTTGGG + Intergenic
1176972453 21:15282260-15282282 CAGAATAATTTGAAGGAATTAGG - Intergenic
1177801025 21:25828906-25828928 CTGAATAATTGGTTGGAGTAGGG - Intergenic
1178630303 21:34253665-34253687 AAGAAGAATGGGGAGTAGTCAGG + Intergenic
1179025051 21:37673119-37673141 AAGAAGAATTGAGAGGAGACGGG + Intronic
1179953411 21:44724207-44724229 CAGAATACTTGGAGGCAGTCTGG - Intergenic
1182615438 22:31585904-31585926 GAAAATAACTGGGAGGAGTTTGG - Intronic
1185165337 22:49258416-49258438 CAGAATACCTGTGAGGACTCAGG - Intergenic
1185214871 22:49592982-49593004 CAGAACAAAAGGGAGGAGTAAGG + Intronic
949464745 3:4332948-4332970 AAGAAACATTGGGAGGAGTTTGG + Intronic
949913569 3:8937550-8937572 CAGAATATTGTGGAGGAGACAGG + Intronic
950133621 3:10564876-10564898 CAGAGTAATTGAGAGTTGTCTGG + Intronic
955134552 3:56203632-56203654 CAAAATAATTGGGATGATTCAGG - Intronic
958832676 3:99108565-99108587 CAGATTAAGTTGGAGGTGTCAGG - Intergenic
958900507 3:99880485-99880507 CAGAATAATTGGAAGCCTTCTGG - Intronic
959689526 3:109183307-109183329 CATACTAGTTGGGAGAAGTCAGG - Intergenic
959838969 3:110951922-110951944 CATAAAATTTGGGAGGGGTCAGG + Intergenic
960293849 3:115918566-115918588 CAGAATAATTGGGCTGACTGTGG - Intronic
962661674 3:137607470-137607492 CAGAATAATATTGAAGAGTCTGG - Intergenic
963266312 3:143243366-143243388 CAGAGTAATTGTGAGGATGCAGG + Intergenic
968032203 3:195509926-195509948 AAGAATAGTTGGGAGGGGCCGGG + Intergenic
970390824 4:15611329-15611351 CAGAACAATTGACAGGAGTCAGG - Intronic
971579147 4:28311449-28311471 CAGAATTATTGCTAGGAGACAGG - Intergenic
971841038 4:31851907-31851929 CATGATATTTGGGAGGGGTCAGG + Intergenic
971857013 4:32057440-32057462 CATAAGATTTGGGAGGGGTCGGG - Intergenic
973795409 4:54420499-54420521 CAGAAGAATGGGTAGGAATCAGG - Intergenic
974471334 4:62322489-62322511 AAGAGTAATTGGGAGGCATCTGG + Intergenic
976449436 4:85170491-85170513 CAGAACAATCTGGAGCAGTCTGG + Intergenic
976496615 4:85737596-85737618 CAAAATAATTGGGAGCAGCAAGG + Intronic
976680670 4:87752837-87752859 CATAAAATTTGGGAGGGGTCAGG - Intergenic
977005946 4:91569794-91569816 CATGATATTTGGGAGGAGGCAGG - Intronic
978083914 4:104626409-104626431 GAGACTAATAGGGAAGAGTCTGG - Intergenic
978247014 4:106585125-106585147 CAGAATCCTTGGAAAGAGTCAGG - Intergenic
978651224 4:111007576-111007598 CAGAAAACTTGGGAGGTATCTGG - Intergenic
978875038 4:113630485-113630507 CAGAATTGTTGGGAGGGCTCAGG + Intronic
978894481 4:113870783-113870805 TAGAATAACTGGGAGTTGTCTGG - Intergenic
979464537 4:121021603-121021625 CAGGAGATTTGGGAGGAGCCAGG - Intergenic
980590877 4:134886658-134886680 GAGATTACTTGGGAGGGGTCTGG + Intergenic
980985502 4:139690963-139690985 CAGAAGAACTGGAAAGAGTCTGG - Intronic
981413575 4:144461602-144461624 CAGCATAATTGGGTTGAGGCAGG - Intergenic
983423894 4:167557722-167557744 CAAAATAATTGTGAGGAGAAGGG - Intergenic
983985839 4:174060043-174060065 CATGATATTTGGGAGGGGTCGGG - Intergenic
984821072 4:183883129-183883151 CAAAATAATTGGGGGGAGGAGGG - Intronic
985872436 5:2568224-2568246 CAGAATAATTGAGGAGAGGCTGG + Intergenic
986149311 5:5112366-5112388 CATAATAATTAAGGGGAGTCTGG - Intergenic
987851483 5:23361322-23361344 CATAAGATTTGGGAGGGGTCAGG - Intergenic
988521348 5:31948088-31948110 AAGGTTACTTGGGAGGAGTCAGG + Intronic
989198106 5:38735630-38735652 CAGAATATTTGGGAAGAGCTAGG + Intergenic
989219440 5:38939669-38939691 TTGAATAATTGGGAGGAATCTGG - Intronic
990213620 5:53507397-53507419 CATGATAATTGGGAGGTGCCCGG - Intergenic
990289416 5:54333637-54333659 CAGAATAAATCAGAGTAGTCAGG + Intergenic
990985502 5:61637808-61637830 CAGAATAATTGGGAGGAGTCTGG + Exonic
994778514 5:104064408-104064430 CCTAAGAATTGGGAGGAGCCAGG + Intergenic
995055510 5:107754504-107754526 CATGATATTTGGGAGGAGCCAGG + Intergenic
996781324 5:127189729-127189751 CAAAGTAATTGGAAGGAATCTGG - Intergenic
998114220 5:139524125-139524147 CAGAATAGTTGTGAGGAGTTTGG + Intergenic
1000440437 5:161256845-161256867 CAGAAAAAGTGGGAGGTGGCTGG - Intergenic
1002318585 5:178361680-178361702 GAGAAGAATTGGGAGCCGTCAGG - Intronic
1004499303 6:16195730-16195752 CAAAATAATTGGGAGAAGCCAGG + Intergenic
1004814831 6:19301626-19301648 CAGAATAATTGGAAGAAGATTGG - Intergenic
1005530655 6:26702040-26702062 CATCATACTTGGGAGGAGTGGGG + Intergenic
1005540141 6:26799606-26799628 CATCATACTTGGGAGGAGTGGGG - Intergenic
1005808508 6:29497548-29497570 AAGAATAACTGGGAGGCCTCAGG - Intergenic
1005898254 6:30196367-30196389 CAGACTAATTGGCAGCAGTAAGG + Intronic
1006866734 6:37214728-37214750 AAGAATATTTGGGATGAATCTGG - Intronic
1006997343 6:38273818-38273840 CAGAATAAAGGAGAAGAGTCAGG + Intronic
1007247405 6:40472434-40472456 CAGAAGAAGTGGGAGGATTTAGG + Intronic
1010180787 6:73084738-73084760 CAGAATAAGTGGGGAGATTCTGG - Intronic
1011364666 6:86568644-86568666 CATACTTATTGGGAGGAGTGGGG + Intergenic
1011979894 6:93360793-93360815 CAGAATTATTGGAAGAACTCAGG - Intronic
1012202431 6:96423503-96423525 CATAATATTTGGGAGGGGCCAGG - Intergenic
1012228506 6:96732647-96732669 CAGATAAATTTGGAGGATTCAGG - Intergenic
1012254639 6:97017486-97017508 CAGAACAAAGGTGAGGAGTCAGG + Intronic
1012967243 6:105687827-105687849 CATGATATTTGGGAGGAGCCAGG + Intergenic
1015222900 6:130825285-130825307 CAGAATAATTGAGAGTAGCTGGG - Intergenic
1016906356 6:149154279-149154301 CAGAACAATTGGGAGGTGTTTGG + Intergenic
1017848049 6:158276701-158276723 CAGAATAATTGGGAAGTGGTGGG + Intronic
1018290960 6:162292258-162292280 CAGAATAACTTGGAAGAGGCCGG - Intronic
1020240149 7:6388115-6388137 CAGCAGAATTGGGTGGAGACAGG + Intronic
1021580539 7:22148254-22148276 CTTAATAATTTGGAGGTGTCAGG + Intronic
1021595218 7:22308590-22308612 CCTAATAATTGGGAGCAATCAGG + Intronic
1021612080 7:22467303-22467325 CAGACTAATTGGGAGCTGGCAGG - Intronic
1024872118 7:53976220-53976242 CTGAATATTGGGGAGGACTCAGG + Intergenic
1030410045 7:109165193-109165215 CAGAAGAATTCAGGGGAGTCAGG + Intergenic
1030754576 7:113272444-113272466 CATAAGATTTGGGAGGAGCCAGG - Intergenic
1030875225 7:114805535-114805557 CAGAATTGTTGTGAGGATTCAGG + Intergenic
1034052330 7:147996441-147996463 CAGAATATTTGGGGGCAGACAGG + Intronic
1035582641 8:749411-749433 TAAAATAATTAGGAGAAGTCTGG - Intergenic
1037917202 8:22779805-22779827 AAGAATAAATGGGAGGAAACAGG + Intronic
1041405794 8:57497903-57497925 CAGAATAATTAGGAGAAATCGGG + Intergenic
1045183243 8:99809554-99809576 CTGAATAATTAAGAGGTGTCTGG - Intronic
1045730323 8:105231492-105231514 CAAGATATTTGGAAGGAGTCAGG + Intronic
1047325150 8:123828876-123828898 GAAAATAATTTAGAGGAGTCAGG - Intergenic
1047680713 8:127251654-127251676 TAGAAAAAAAGGGAGGAGTCAGG - Intergenic
1048033901 8:130658624-130658646 CTGAATAATAGGAGGGAGTCAGG + Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1050560613 9:6831319-6831341 CAGAAGAATTGGGAGGAGTATGG - Intronic
1052078962 9:24179865-24179887 CATGAGATTTGGGAGGAGTCAGG - Intergenic
1052407080 9:28074850-28074872 CAGAATAAGTGATAGGAGTGGGG + Intronic
1053041582 9:34878184-34878206 CAGAAAAATTGAGTGGAGTATGG - Intergenic
1053375212 9:37600374-37600396 CAGAATAAATAGGAGGTGGCCGG - Intronic
1055476705 9:76669833-76669855 CAGAAGACTCGGGAGGAGTGAGG - Intronic
1057386293 9:94608491-94608513 CAGAAGAATGGGAAGCAGTCAGG + Intronic
1058977153 9:110135830-110135852 CAAAATACTTGGGAAGACTCTGG + Intronic
1059562261 9:115347073-115347095 CATGATATTTGGGAGGTGTCAGG - Intronic
1059820628 9:117968415-117968437 AAGAATAATTGAGAGGAATATGG - Intergenic
1186436081 X:9544154-9544176 CATAATAATTAGTAGGAGTTTGG - Intronic
1186887379 X:13927652-13927674 GAAACTAATTGGGAGGAGGCAGG + Intronic
1187427238 X:19189290-19189312 CACAATTATTGTGAGGAATCGGG - Intergenic
1187807891 X:23141108-23141130 CAGAATAATGGGTAGGATTTAGG - Intergenic
1188995892 X:36884840-36884862 GAGAATATATGGGATGAGTCTGG - Intergenic
1189197590 X:39165291-39165313 CATAACAATTGGCAAGAGTCAGG + Intergenic
1189474035 X:41335046-41335068 CAGAAGATTGGGGAGGAGTGGGG + Intronic
1189751846 X:44230498-44230520 CAAAAAAAGTGGGAGGAGTAGGG - Intronic
1190780263 X:53587131-53587153 CAGAATAATTGTGATGATTGAGG + Intronic
1190959026 X:55227250-55227272 CAGAAAATTGGGGAGGAGTGGGG + Intronic
1193334105 X:80267119-80267141 CAGAAGAATTGGGATGACTCAGG + Intergenic
1193566024 X:83078181-83078203 CAGCATAATTGGAATGAGTCAGG - Intergenic
1194373130 X:93099028-93099050 CATGAGATTTGGGAGGAGTCAGG + Intergenic
1195122160 X:101765731-101765753 CAAAATAAATGGGAAGCGTCCGG + Intergenic
1195838935 X:109150782-109150804 CATGAGATTTGGGAGGAGTCAGG + Intergenic
1196664720 X:118304460-118304482 CAGGATATTTGGGAGGGGCCAGG - Intergenic
1197944346 X:131822267-131822289 CGGAATAATTCAGAGAAGTCAGG + Intergenic
1202329911 Y:23738150-23738172 CAGGATGATTGGGAGGTGACTGG + Intergenic
1202540859 Y:25931904-25931926 CAGGATGATTGGGAGGTGACTGG - Intergenic