ID: 990988214 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:61660642-61660664 |
| Sequence | CCTTCCTCTCTGGCCATGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 990988214_990988220 | -1 | Left | 990988214 | 5:61660642-61660664 | CCCTCCATGGCCAGAGAGGAAGG | No data | ||
| Right | 990988220 | 5:61660664-61660686 | GTAGGTCAAACACATATCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 990988214 | Original CRISPR | CCTTCCTCTCTGGCCATGGA GGG (reversed) | Intronic | ||