ID: 990988214

View in Genome Browser
Species Human (GRCh38)
Location 5:61660642-61660664
Sequence CCTTCCTCTCTGGCCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990988214_990988220 -1 Left 990988214 5:61660642-61660664 CCCTCCATGGCCAGAGAGGAAGG No data
Right 990988220 5:61660664-61660686 GTAGGTCAAACACATATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990988214 Original CRISPR CCTTCCTCTCTGGCCATGGA GGG (reversed) Intronic