ID: 990988216 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:61660643-61660665 |
| Sequence | ACCTTCCTCTCTGGCCATGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 296 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 30, 4: 264} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 990988216_990988220 | -2 | Left | 990988216 | 5:61660643-61660665 | CCTCCATGGCCAGAGAGGAAGGT | 0: 1 1: 0 2: 1 3: 30 4: 264 |
||
| Right | 990988220 | 5:61660664-61660686 | GTAGGTCAAACACATATCCTTGG | 0: 1 1: 0 2: 0 3: 3 4: 99 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 990988216 | Original CRISPR | ACCTTCCTCTCTGGCCATGG AGG (reversed) | Intronic | ||