ID: 990988216

View in Genome Browser
Species Human (GRCh38)
Location 5:61660643-61660665
Sequence ACCTTCCTCTCTGGCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990988216_990988220 -2 Left 990988216 5:61660643-61660665 CCTCCATGGCCAGAGAGGAAGGT 0: 1
1: 0
2: 1
3: 30
4: 264
Right 990988220 5:61660664-61660686 GTAGGTCAAACACATATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990988216 Original CRISPR ACCTTCCTCTCTGGCCATGG AGG (reversed) Intronic