ID: 990988217

View in Genome Browser
Species Human (GRCh38)
Location 5:61660646-61660668
Sequence CCTACCTTCCTCTCTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 357}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990988217_990988223 28 Left 990988217 5:61660646-61660668 CCATGGCCAGAGAGGAAGGTAGG 0: 1
1: 0
2: 2
3: 38
4: 357
Right 990988223 5:61660697-61660719 ACCTCTCGTTGTGCTTACCCTGG 0: 1
1: 0
2: 0
3: 1
4: 49
990988217_990988220 -5 Left 990988217 5:61660646-61660668 CCATGGCCAGAGAGGAAGGTAGG 0: 1
1: 0
2: 2
3: 38
4: 357
Right 990988220 5:61660664-61660686 GTAGGTCAAACACATATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990988217 Original CRISPR CCTACCTTCCTCTCTGGCCA TGG (reversed) Intronic