ID: 990988220

View in Genome Browser
Species Human (GRCh38)
Location 5:61660664-61660686
Sequence GTAGGTCAAACACATATCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990988214_990988220 -1 Left 990988214 5:61660642-61660664 CCCTCCATGGCCAGAGAGGAAGG No data
Right 990988220 5:61660664-61660686 GTAGGTCAAACACATATCCTTGG No data
990988216_990988220 -2 Left 990988216 5:61660643-61660665 CCTCCATGGCCAGAGAGGAAGGT 0: 1
1: 0
2: 1
3: 30
4: 264
Right 990988220 5:61660664-61660686 GTAGGTCAAACACATATCCTTGG No data
990988217_990988220 -5 Left 990988217 5:61660646-61660668 CCATGGCCAGAGAGGAAGGTAGG 0: 1
1: 0
2: 2
3: 38
4: 357
Right 990988220 5:61660664-61660686 GTAGGTCAAACACATATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990988220 Original CRISPR GTAGGTCAAACACATATCCT TGG Intronic