ID: 990988863

View in Genome Browser
Species Human (GRCh38)
Location 5:61665834-61665856
Sequence TCTACTGCCCAGAAGCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990988853_990988863 29 Left 990988853 5:61665782-61665804 CCTTTTAGAACTTGTGGAGGGCA 0: 1
1: 0
2: 2
3: 7
4: 120
Right 990988863 5:61665834-61665856 TCTACTGCCCAGAAGCATCATGG 0: 1
1: 0
2: 0
3: 12
4: 145
990988858_990988863 6 Left 990988858 5:61665805-61665827 CCGAACTGACAGCTTGGGGGCGG 0: 1
1: 0
2: 1
3: 5
4: 77
Right 990988863 5:61665834-61665856 TCTACTGCCCAGAAGCATCATGG 0: 1
1: 0
2: 0
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990988863 Original CRISPR TCTACTGCCCAGAAGCATCA TGG Intronic
900341460 1:2191278-2191300 GCTACTGAGCAGAAGCGTCACGG - Intronic
900793924 1:4696256-4696278 GCCACTGCTCAGAAGCACCAGGG + Intronic
904265785 1:29317954-29317976 TCCCCTTCCCAGCAGCATCAGGG + Intronic
904476727 1:30769826-30769848 GCTGCTTCCCAGAAGCCTCAGGG + Intergenic
907717942 1:56945069-56945091 TCTATTGGCCAGCAGCATCAGGG + Intronic
909426341 1:75529476-75529498 TCTACTCTACAGAAGAATCAGGG + Intronic
912467659 1:109885061-109885083 TCCAATGAGCAGAAGCATCATGG + Intergenic
912656532 1:111490935-111490957 TCTACTGCCCAGAATTTTCTTGG - Intronic
915313705 1:155016951-155016973 TCTACTCCCCAGGAGCAGCTGGG - Exonic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916650949 1:166834013-166834035 TCTCCTTGCCAGAAGCATTAGGG - Intergenic
919422706 1:197390459-197390481 TCTACTGCCCAGGAGAATGTTGG - Intronic
920503116 1:206497817-206497839 TCTAGTACCCAGGAACATCAAGG - Intergenic
921720266 1:218463505-218463527 TGTGGTGCCCAGAAGCATAAAGG - Intergenic
1067741477 10:48898819-48898841 AGCACTGCCCAGAACCATCAGGG - Intronic
1069606734 10:69743602-69743624 CCCACTGCACAGAAGCAGCATGG + Intergenic
1069636495 10:69928467-69928489 TCTGCTGAGCAGAAGCATCCAGG - Intronic
1069833383 10:71294380-71294402 TCAGCTTCCCAGAAGCCTCAGGG + Intronic
1072312995 10:94174725-94174747 TCTACTCTTCAAAAGCATCAAGG + Intronic
1073367200 10:102952859-102952881 TTTCCAGCCCAGAACCATCAAGG - Intronic
1075127726 10:119713907-119713929 GGCACTGCCCAGAAGCAGCAAGG - Intergenic
1076510603 10:131011491-131011513 TCTACTGGCCAGAAGACTGAGGG + Intergenic
1078151346 11:8762082-8762104 TGTACTCCCCACCAGCATCATGG + Intronic
1080468776 11:32525062-32525084 TCTCCTTCCCACAGGCATCATGG - Intergenic
1081600876 11:44493039-44493061 TCTTCAGGCCAGAAACATCAAGG - Intergenic
1088746850 11:112811171-112811193 TCTGTTGCCCAGGAGCATGAAGG - Intergenic
1093686772 12:22065189-22065211 TCTACTGCCCAGAAGGCTGTTGG + Exonic
1094143896 12:27208909-27208931 ACTAATGCCCAGAATCTTCAAGG + Intergenic
1096899142 12:54856439-54856461 ACTACTGCTCAGAAGCAATAAGG - Intronic
1101083434 12:101211424-101211446 TCCAATTCCCAGAAGGATCAAGG - Intergenic
1101610708 12:106289030-106289052 TCTGCAGCCCAGTAGCTTCAGGG - Intronic
1102022526 12:109694039-109694061 CCTACTCCCCAGAAGCAACAAGG - Intergenic
1103045654 12:117732636-117732658 TCCACTTCCCAGAAGCTTCAAGG - Intronic
1103291008 12:119846222-119846244 GCTACTGCTCAGTAGCTTCAGGG - Intronic
1105330305 13:19409906-19409928 TCCACTGGGCACAAGCATCATGG - Intergenic
1105918388 13:24938731-24938753 TCCACTGTGCACAAGCATCATGG - Intergenic
1108394099 13:49976425-49976447 TGCCCTGCCCAGAAGCAACACGG - Intergenic
1109555987 13:63976312-63976334 TCTACTGACTTGAAACATCAAGG + Intergenic
1112133090 13:96545475-96545497 TCTTCTGCCCATGATCATCAAGG - Intronic
1114742988 14:25117445-25117467 TCTAGTGATCAGAAGCATGAGGG - Intergenic
1115154229 14:30320181-30320203 TCTACTCACCAGATGCATCCTGG - Intergenic
1117471573 14:56051279-56051301 CCTACTTACCAGAAGCTTCAAGG + Intergenic
1117665903 14:58055605-58055627 TCCACAGACCAGCAGCATCAGGG + Intronic
1119688331 14:76651091-76651113 TCTTCTGCCCAGAGGTCTCAAGG + Intergenic
1128671209 15:69576018-69576040 TCTACTTCCCAGAAGGATCCAGG - Intergenic
1129249329 15:74299989-74300011 GCCAGTGCCCAGAAGGATCATGG + Intronic
1131668165 15:94591917-94591939 TCCTCAGGCCAGAAGCATCAGGG + Intergenic
1132507401 16:318333-318355 TCCACTGCACACAAGCACCAAGG + Intronic
1134829272 16:17310191-17310213 GATACTGCCCAGAAGCAAGAGGG - Intronic
1136289832 16:29264873-29264895 CCTCCTTCCCAGCAGCATCAGGG - Intergenic
1138188208 16:54993002-54993024 TCTCCTGCCCAGAAGCAATCTGG - Intergenic
1142095716 16:88238349-88238371 CCTCCTTCCCAGCAGCATCAGGG - Intergenic
1143456993 17:7074690-7074712 TGGACTGCCCAGAGGCATGAGGG + Exonic
1148092209 17:45029430-45029452 TCTGCTACCCAGAAGCTTCCCGG - Intronic
1151957571 17:77388055-77388077 ACTTCTGCCCAGAAGCCTCACGG - Intronic
1156886093 18:42138226-42138248 TAAACTACCCAGAACCATCAAGG - Intergenic
1157167874 18:45375094-45375116 TCTACAGCCAGGAAGCAACAAGG - Intronic
1157489539 18:48113180-48113202 TCTACTGGCCAGCAGGTTCAGGG - Intronic
1157899819 18:51504158-51504180 TCTAATGACCATAAGCTTCATGG - Intergenic
1158182991 18:54738940-54738962 TTGACTGCAAAGAAGCATCAGGG - Intronic
1160319952 18:77881009-77881031 TCTCATTCCCAGAAGCATCCTGG + Intergenic
1160544731 18:79645410-79645432 TCTGCTGCCCAGCAGCAGGAAGG + Intergenic
1165090013 19:33381310-33381332 TCTCCTGCCCAGAAACGGCACGG - Exonic
1165091240 19:33389414-33389436 TCTCCTGCCCAGAAGCTGCTGGG + Intronic
1165920320 19:39293420-39293442 TCTACTGCCCACATGCAGAATGG - Intergenic
928129350 2:28638425-28638447 TCTACTGCTTAGAAGCATCTAGG - Intronic
931009088 2:57886904-57886926 TGCACTGCCCAGAATCCTCATGG + Intergenic
932160769 2:69457318-69457340 TCTACTGCCAACCAGCCTCAGGG + Intergenic
933100683 2:78252878-78252900 CCTACAGCCCAAAAACATCAAGG - Intergenic
933792450 2:85893920-85893942 TCTGCTGCCCTGAAGCACAAAGG + Intergenic
938043460 2:128095552-128095574 TCTGTTGCCCAGATGCAGCATGG + Intronic
939636021 2:144583423-144583445 TCTACTGCCCAGACGAATGTAGG + Intergenic
939841080 2:147187637-147187659 TCTACTACCCAGAATCTACAAGG + Intergenic
941036220 2:160571720-160571742 TCTGCTTCCCAAAATCATCAGGG - Intergenic
948167229 2:235872561-235872583 TCTTCTGGCCAGTAGGATCACGG + Intronic
1171023767 20:21610182-21610204 TCTCCAGCCCAGCAGCTTCAGGG - Intergenic
1171781748 20:29425591-29425613 TCTAATGTCCAGAATAATCAAGG + Intergenic
1173219999 20:41124845-41124867 TGTACTGGCCAGAAGCAGAAGGG + Intergenic
1174571841 20:51507703-51507725 TCTACTTCCAAGAGGCAGCATGG + Intronic
1175368134 20:58469436-58469458 TCTTCTCCCAAGAAGCAGCAAGG + Intronic
1175915449 20:62423811-62423833 TCTTCTCCCCAAAAGCACCAAGG - Intronic
1176237410 20:64060065-64060087 TCAACGTCCCAGAAGCATCAAGG - Intronic
1177252948 21:18620216-18620238 TGTGCTACCTAGAAGCATCATGG + Intergenic
1177641549 21:23850136-23850158 TCAACTGAGCAGAAGCAGCAAGG - Intergenic
1179999057 21:44986955-44986977 CCTCCTTCCCAGAAGCATCCTGG + Intergenic
1180564582 22:16651921-16651943 TCCACTGGGCACAAGCATCATGG + Intergenic
1181011105 22:20041048-20041070 TCTGCTGGCAAGAAGCTTCAGGG + Intronic
1182252775 22:29014725-29014747 TCTACTGACCAGGAGCCCCATGG - Intronic
1182877439 22:33704495-33704517 GGTACTGCCCAGAAGGATCATGG - Intronic
951593504 3:24292393-24292415 TTCAGTCCCCAGAAGCATCAGGG + Intronic
956073130 3:65475796-65475818 CCTATTGGCCAGAAGCATCTGGG - Intronic
957349122 3:79000299-79000321 TCTACTACCCAGAATCTACAAGG - Intronic
962525504 3:136234273-136234295 TCCACTGCCCAGCAGCAAAAAGG + Intergenic
966121678 3:176528649-176528671 TTTAGTGCCCACAAGAATCACGG + Intergenic
966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG + Intergenic
967107251 3:186263983-186264005 TGTGATGCCCAGAAGCATCTTGG + Intronic
968361093 3:198147411-198147433 TGCACTGCCCTGGAGCATCAAGG + Intergenic
968732749 4:2278016-2278038 TCCACTGCCCATAAGCATATGGG - Intronic
969294908 4:6264029-6264051 TCTACGGCCCAGCAGCTGCAGGG + Intergenic
969602035 4:8182359-8182381 TCACCTGGCCAGAAGCAGCAGGG + Intronic
971808601 4:31394105-31394127 TATACTGGCCAAAAGCCTCATGG - Intergenic
973641834 4:52910866-52910888 TCTTCTTCACAGCAGCATCAGGG - Intronic
976529201 4:86131984-86132006 TCTACTGACTAGAAGCAGAAAGG - Intronic
976803527 4:89020030-89020052 TCTTTGGCCCAAAAGCATCAGGG + Intronic
980486130 4:133460059-133460081 TCTATTACCCAATAGCATCATGG + Intergenic
981419673 4:144534720-144534742 TCTGCTGCACAGAAGGGTCATGG - Intergenic
981450466 4:144891256-144891278 TCTACTGGCAAGAATGATCATGG + Intergenic
981908736 4:149953646-149953668 TCTGCTGCCCAAATGCATCAAGG - Intergenic
983744852 4:171185185-171185207 TTTACTGCCTTGAAGCATCAAGG - Intergenic
985638543 5:1052342-1052364 CCTAATGCCCAACAGCATCACGG - Exonic
985697819 5:1351395-1351417 TCGACTGCCCATCAGCATCTGGG - Intergenic
986314138 5:6574866-6574888 TCTCCTGTCCCGAGGCATCAAGG + Intergenic
990988863 5:61665834-61665856 TCTACTGCCCAGAAGCATCATGG + Intronic
994198065 5:96941657-96941679 TTTACTGTCCAGAAACACCAAGG - Intronic
995596060 5:113749257-113749279 CCTACTGCCCAGAAAAACCAAGG + Intergenic
997258192 5:132445305-132445327 TTAACTGCCCTGAAGCTTCATGG + Intronic
998581612 5:143382934-143382956 TCTACTGCCCACAGTCATCCTGG + Intronic
999669587 5:153947055-153947077 TCTATTGCCCAGGAGAATGAAGG + Intergenic
1000380471 5:160624464-160624486 TCTACTTACCAGAAGCAAGAGGG + Intronic
1000792286 5:165622538-165622560 TCTACCACCCAGAAGCTTCAGGG + Intergenic
1003211139 6:4067826-4067848 TTTACTGCCCCTAAGAATCAAGG - Intronic
1008805590 6:55423306-55423328 TTTATTGCCCAGATCCATCAGGG + Intergenic
1012450275 6:99347662-99347684 TCCACTGCTGAGAAGCCTCATGG + Intronic
1013703843 6:112808543-112808565 TATATAGCCCAGAAGCTTCAGGG + Intergenic
1014972530 6:127835256-127835278 TCTACTGCCCAAAATCACCTAGG - Intronic
1017943203 6:159071617-159071639 TCTATTTCCCAGAAGCCTCCAGG + Intergenic
1019258916 7:69243-69265 TGCACTGCCCTGGAGCATCAAGG - Intergenic
1022274374 7:28841365-28841387 TCTTCTCCCCAGCAGCACCATGG - Intergenic
1022361202 7:29659838-29659860 TATAATGACCATAAGCATCATGG - Intergenic
1025819980 7:64953996-64954018 TGTACTGCCCTGAAATATCAAGG + Intergenic
1030289714 7:107859869-107859891 CCTGCTGCCAACAAGCATCAAGG - Intergenic
1031809008 7:126342781-126342803 TCTACTGCTCAGTAACATGATGG + Intergenic
1032356339 7:131214554-131214576 TCAACAGCACAGCAGCATCATGG - Intronic
1032521320 7:132547633-132547655 CCTACTGTACAGAAGAATCAAGG + Intronic
1034373795 7:150626401-150626423 TCAACTCCCCAGGAGCATCTTGG + Exonic
1036091078 8:5666032-5666054 TCTACTTCCCAGAAACAGTAAGG - Intergenic
1037539964 8:19861701-19861723 GCTACTGCCCTCTAGCATCAAGG - Intergenic
1038002858 8:23405262-23405284 TCTACTGCCCACCAGAGTCAGGG - Intronic
1038410348 8:27353701-27353723 TCTACTGCTCAGCTGCATGAAGG + Intronic
1042444677 8:68870482-68870504 TCTACTGCCCAGAAGTCATATGG - Intergenic
1047494457 8:125399603-125399625 TCCACTTCCCAGGAGCATCCAGG + Intergenic
1047837774 8:128713010-128713032 TCTATTGCTCAAAAGCAACAAGG + Intergenic
1049694015 8:143974907-143974929 TCCAGTGCCCAGATGCAACAAGG - Intronic
1050489597 9:6173592-6173614 TTTCCAGCCCAGAAGGATCAGGG - Intergenic
1054848843 9:69825546-69825568 TCTCTGGCTCAGAAGCATCAAGG - Intronic
1060754911 9:126205746-126205768 TCTACTCCCCAGAGGCTGCAGGG - Intergenic
1062371748 9:136242837-136242859 TCTACCTCCCACAAGCCTCATGG + Intronic
1062745803 9:138211239-138211261 TGCACTGCCCTGGAGCATCAAGG + Intergenic
1187319313 X:18226192-18226214 TCTCCTCCCCAGAAACGTCAAGG - Intergenic
1189166972 X:38870067-38870089 CCTACTCCCCAGAAGCAGCCTGG - Intergenic
1190285958 X:48961631-48961653 GCAACAGTCCAGAAGCATCAGGG - Exonic
1195198718 X:102525204-102525226 TCTAATACCCAGAATCTTCAAGG + Intergenic
1195365148 X:104117434-104117456 TCTACTGGCCATGAGCATTAAGG - Intronic
1195967880 X:110445514-110445536 TCTACTTCCCTGAATGATCAAGG + Intronic
1195981988 X:110588949-110588971 TAAAATGCACAGAAGCATCAAGG + Intergenic
1198436612 X:136623078-136623100 TCCACTATCCAGAACCATCAGGG - Intergenic
1198507844 X:137318849-137318871 TCCACTGTCTAGAAGAATCAGGG - Intergenic
1202600998 Y:26592901-26592923 TCTACTGGGCACAAGCATCATGG + Intergenic