ID: 990992594

View in Genome Browser
Species Human (GRCh38)
Location 5:61700395-61700417
Sequence GCCTGGCCACGAGTGTGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990992591_990992594 -10 Left 990992591 5:61700382-61700404 CCCACTGTGAACTGCCTGGCCAC 0: 1
1: 0
2: 2
3: 10
4: 252
Right 990992594 5:61700395-61700417 GCCTGGCCACGAGTGTGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 80
990992589_990992594 11 Left 990992589 5:61700361-61700383 CCTTTGAGCAGTCAGCTGTGTCC 0: 1
1: 0
2: 1
3: 15
4: 146
Right 990992594 5:61700395-61700417 GCCTGGCCACGAGTGTGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990992594 Original CRISPR GCCTGGCCACGAGTGTGCGT GGG Intronic