ID: 991001502

View in Genome Browser
Species Human (GRCh38)
Location 5:61788099-61788121
Sequence GTTCCTAAATTCCTTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991001502_991001506 27 Left 991001502 5:61788099-61788121 CCTCACAGAAGGAATTTAGGAAC No data
Right 991001506 5:61788149-61788171 TACTGTTGTGTGGATACCTTGGG No data
991001502_991001504 17 Left 991001502 5:61788099-61788121 CCTCACAGAAGGAATTTAGGAAC No data
Right 991001504 5:61788139-61788161 ATTTTTTCTCTACTGTTGTGTGG No data
991001502_991001505 26 Left 991001502 5:61788099-61788121 CCTCACAGAAGGAATTTAGGAAC No data
Right 991001505 5:61788148-61788170 CTACTGTTGTGTGGATACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991001502 Original CRISPR GTTCCTAAATTCCTTCTGTG AGG (reversed) Intergenic
No off target data available for this crispr