ID: 991004426

View in Genome Browser
Species Human (GRCh38)
Location 5:61813670-61813692
Sequence TAGGGTTGTTTTGAAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991004426_991004432 27 Left 991004426 5:61813670-61813692 CCAGGAACTTCAAAACAACCCTA No data
Right 991004432 5:61813720-61813742 TTTAAGAAATAAACAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991004426 Original CRISPR TAGGGTTGTTTTGAAGTTCC TGG (reversed) Intergenic
No off target data available for this crispr