ID: 991004872

View in Genome Browser
Species Human (GRCh38)
Location 5:61818169-61818191
Sequence CCTAGTTGTGAGTAGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991004872_991004877 15 Left 991004872 5:61818169-61818191 CCTGGGCTCTACTCACAACTAGG No data
Right 991004877 5:61818207-61818229 TTAACCTCAAATGTTCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991004872 Original CRISPR CCTAGTTGTGAGTAGAGCCC AGG (reversed) Intergenic
No off target data available for this crispr