ID: 991009115

View in Genome Browser
Species Human (GRCh38)
Location 5:61863907-61863929
Sequence CATCATATATTGAAGATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991009115_991009116 15 Left 991009115 5:61863907-61863929 CCTTCAATCTTCAATATATGATG No data
Right 991009116 5:61863945-61863967 ATGATCAGCATACCATTAAGTGG 0: 13
1: 24
2: 23
3: 43
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991009115 Original CRISPR CATCATATATTGAAGATTGA AGG (reversed) Intergenic
No off target data available for this crispr