ID: 991009481

View in Genome Browser
Species Human (GRCh38)
Location 5:61868016-61868038
Sequence CCATCTTTGCAGGTGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991009477_991009481 -6 Left 991009477 5:61867999-61868021 CCTCTATTCTGCTGGGACCATCT No data
Right 991009481 5:61868016-61868038 CCATCTTTGCAGGTGCAGCAGGG No data
991009470_991009481 28 Left 991009470 5:61867965-61867987 CCAGTTGGTAGGTACTGAGAAGG No data
Right 991009481 5:61868016-61868038 CCATCTTTGCAGGTGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991009481 Original CRISPR CCATCTTTGCAGGTGCAGCA GGG Intergenic
No off target data available for this crispr