ID: 991013809

View in Genome Browser
Species Human (GRCh38)
Location 5:61910929-61910951
Sequence AGTTATCTGCAGAAGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991013805_991013809 15 Left 991013805 5:61910891-61910913 CCCATAAGAGTCCAAGGGCTGTC No data
Right 991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG No data
991013808_991013809 4 Left 991013808 5:61910902-61910924 CCAAGGGCTGTCTCTCAAAAGGA No data
Right 991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG No data
991013806_991013809 14 Left 991013806 5:61910892-61910914 CCATAAGAGTCCAAGGGCTGTCT No data
Right 991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG No data
991013803_991013809 17 Left 991013803 5:61910889-61910911 CCCCCATAAGAGTCCAAGGGCTG No data
Right 991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG No data
991013804_991013809 16 Left 991013804 5:61910890-61910912 CCCCATAAGAGTCCAAGGGCTGT No data
Right 991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991013809 Original CRISPR AGTTATCTGCAGAAGATAGC AGG Intergenic
No off target data available for this crispr