ID: 991019487

View in Genome Browser
Species Human (GRCh38)
Location 5:61964967-61964989
Sequence CTTGAAAGAAGCAGAAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991019482_991019487 16 Left 991019482 5:61964928-61964950 CCCTGGGAAAGGTGCAGAGATGA No data
Right 991019487 5:61964967-61964989 CTTGAAAGAAGCAGAAGTGGTGG No data
991019483_991019487 15 Left 991019483 5:61964929-61964951 CCTGGGAAAGGTGCAGAGATGAA No data
Right 991019487 5:61964967-61964989 CTTGAAAGAAGCAGAAGTGGTGG No data
991019484_991019487 -10 Left 991019484 5:61964954-61964976 CCACCATTAAAAACTTGAAAGAA No data
Right 991019487 5:61964967-61964989 CTTGAAAGAAGCAGAAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991019487 Original CRISPR CTTGAAAGAAGCAGAAGTGG TGG Intergenic
No off target data available for this crispr