ID: 991021665

View in Genome Browser
Species Human (GRCh38)
Location 5:61985698-61985720
Sequence ACCAGGATGTTGTAGGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991021665_991021673 28 Left 991021665 5:61985698-61985720 CCTCTTCCCTACAACATCCTGGT No data
Right 991021673 5:61985749-61985771 TCTGATCCATTCAAGCAGCAAGG No data
991021665_991021668 -10 Left 991021665 5:61985698-61985720 CCTCTTCCCTACAACATCCTGGT No data
Right 991021668 5:61985711-61985733 ACATCCTGGTGAGTACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991021665 Original CRISPR ACCAGGATGTTGTAGGGAAG AGG (reversed) Intergenic
No off target data available for this crispr